ID: 1201419468

View in Genome Browser
Species Human (GRCh38)
Location Y:13782505-13782527
Sequence ACTCAAGCCTGGGCAATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8689
Summary {0: 59, 1: 785, 2: 2481, 3: 1672, 4: 3692}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419462_1201419468 -3 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201419459_1201419468 14 Left 1201419459 Y:13782468-13782490 CCACCCAGTTTGAACTTCCTTGC No data
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201419461_1201419468 10 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201419460_1201419468 11 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419468 Original CRISPR ACTCAAGCCTGGGCAATGGC GGG Intergenic
Too many off-targets to display for this crispr