ID: 1201421473

View in Genome Browser
Species Human (GRCh38)
Location Y:13804542-13804564
Sequence CAGCAAACAGCAGTAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201421473_1201421479 23 Left 1201421473 Y:13804542-13804564 CCCTCCACTACTGCTGTTTGCTG No data
Right 1201421479 Y:13804588-13804610 TCCACCCCTCCAGATCCAGCAGG 0: 15
1: 48
2: 81
3: 158
4: 318
1201421473_1201421481 24 Left 1201421473 Y:13804542-13804564 CCCTCCACTACTGCTGTTTGCTG No data
Right 1201421481 Y:13804589-13804611 CCACCCCTCCAGATCCAGCAGGG 0: 16
1: 50
2: 105
3: 152
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201421473 Original CRISPR CAGCAAACAGCAGTAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr