ID: 1201428176

View in Genome Browser
Species Human (GRCh38)
Location Y:13877112-13877134
Sequence CTGTGTCAAGGAAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201428170_1201428176 -3 Left 1201428170 Y:13877092-13877114 CCAGGTTTGACAACTTCAGGCTG No data
Right 1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201428176 Original CRISPR CTGTGTCAAGGAAAGGGGGA AGG Intergenic
No off target data available for this crispr