ID: 1201433780

View in Genome Browser
Species Human (GRCh38)
Location Y:13933699-13933721
Sequence CTAGTTTTCCAGGTAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201433780_1201433787 6 Left 1201433780 Y:13933699-13933721 CCAAAATTTACCTGGAAAACTAG No data
Right 1201433787 Y:13933728-13933750 CAATGATAAGAAGGGGGAGTTGG No data
1201433780_1201433785 -1 Left 1201433780 Y:13933699-13933721 CCAAAATTTACCTGGAAAACTAG No data
Right 1201433785 Y:13933721-13933743 GTTCAGGCAATGATAAGAAGGGG No data
1201433780_1201433783 -3 Left 1201433780 Y:13933699-13933721 CCAAAATTTACCTGGAAAACTAG No data
Right 1201433783 Y:13933719-13933741 TAGTTCAGGCAATGATAAGAAGG No data
1201433780_1201433784 -2 Left 1201433780 Y:13933699-13933721 CCAAAATTTACCTGGAAAACTAG No data
Right 1201433784 Y:13933720-13933742 AGTTCAGGCAATGATAAGAAGGG No data
1201433780_1201433786 0 Left 1201433780 Y:13933699-13933721 CCAAAATTTACCTGGAAAACTAG No data
Right 1201433786 Y:13933722-13933744 TTCAGGCAATGATAAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201433780 Original CRISPR CTAGTTTTCCAGGTAAATTT TGG (reversed) Intergenic
No off target data available for this crispr