ID: 1201437702

View in Genome Browser
Species Human (GRCh38)
Location Y:13977362-13977384
Sequence CACTGTGCTTGAGGGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201437699_1201437702 2 Left 1201437699 Y:13977337-13977359 CCGTGGCATGGGTGAGTCTCAAG No data
Right 1201437702 Y:13977362-13977384 CACTGTGCTTGAGGGAAATAAGG No data
1201437695_1201437702 19 Left 1201437695 Y:13977320-13977342 CCATGCATGGATACACACCGTGG No data
Right 1201437702 Y:13977362-13977384 CACTGTGCTTGAGGGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201437702 Original CRISPR CACTGTGCTTGAGGGAAATA AGG Intergenic
No off target data available for this crispr