ID: 1201440218

View in Genome Browser
Species Human (GRCh38)
Location Y:14000682-14000704
Sequence AACCCCGTGCTCTCTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201440218_1201440224 11 Left 1201440218 Y:14000682-14000704 CCTGTTTCAGAGAGCACGGGGTT No data
Right 1201440224 Y:14000716-14000738 CATAGATTAACAGCATCCCAAGG 0: 31
1: 644
2: 459
3: 1481
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201440218 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr