ID: 1201440224

View in Genome Browser
Species Human (GRCh38)
Location Y:14000716-14000738
Sequence CATAGATTAACAGCATCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3068
Summary {0: 31, 1: 644, 2: 459, 3: 1481, 4: 453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201440218_1201440224 11 Left 1201440218 Y:14000682-14000704 CCTGTTTCAGAGAGCACGGGGTT No data
Right 1201440224 Y:14000716-14000738 CATAGATTAACAGCATCCCAAGG 0: 31
1: 644
2: 459
3: 1481
4: 453
1201440213_1201440224 29 Left 1201440213 Y:14000664-14000686 CCCTGAGTGGACACAGCACCTGT No data
Right 1201440224 Y:14000716-14000738 CATAGATTAACAGCATCCCAAGG 0: 31
1: 644
2: 459
3: 1481
4: 453
1201440214_1201440224 28 Left 1201440214 Y:14000665-14000687 CCTGAGTGGACACAGCACCTGTT No data
Right 1201440224 Y:14000716-14000738 CATAGATTAACAGCATCCCAAGG 0: 31
1: 644
2: 459
3: 1481
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201440224 Original CRISPR CATAGATTAACAGCATCCCA AGG Intergenic
Too many off-targets to display for this crispr