ID: 1201444353

View in Genome Browser
Species Human (GRCh38)
Location Y:14042026-14042048
Sequence AACCCCGTGCTCTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201444347_1201444353 11 Left 1201444347 Y:14041992-14042014 CCTTGGGATGCTGTTAATCTATG 0: 31
1: 644
2: 459
3: 1481
4: 453
Right 1201444353 Y:14042026-14042048 AACCCCGTGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201444353 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG Intergenic
No off target data available for this crispr