ID: 1201444927

View in Genome Browser
Species Human (GRCh38)
Location Y:14048775-14048797
Sequence AACATTACAGGTTAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201444927_1201444929 -7 Left 1201444927 Y:14048775-14048797 CCATAGATCTAACCTGTAATGTT No data
Right 1201444929 Y:14048791-14048813 TAATGTTAGACCAGACCTCCAGG No data
1201444927_1201444933 17 Left 1201444927 Y:14048775-14048797 CCATAGATCTAACCTGTAATGTT No data
Right 1201444933 Y:14048815-14048837 TATTCCCCTTATAGATTCAGAGG No data
1201444927_1201444937 25 Left 1201444927 Y:14048775-14048797 CCATAGATCTAACCTGTAATGTT No data
Right 1201444937 Y:14048823-14048845 TTATAGATTCAGAGGCCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201444927 Original CRISPR AACATTACAGGTTAGATCTA TGG (reversed) Intergenic
No off target data available for this crispr