ID: 1201445927

View in Genome Browser
Species Human (GRCh38)
Location Y:14057070-14057092
Sequence TGGTGGGTGGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13236
Summary {0: 2, 1: 1, 2: 126, 3: 958, 4: 12149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201445927 Original CRISPR TGGTGGGTGGGGAGGGAGGA AGG Intergenic
Too many off-targets to display for this crispr