ID: 1201446311

View in Genome Browser
Species Human (GRCh38)
Location Y:14059603-14059625
Sequence CGTGACATGCAGAGCTTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201446311_1201446313 21 Left 1201446311 Y:14059603-14059625 CCGTTCAAGCTCTGCATGTCACG No data
Right 1201446313 Y:14059647-14059669 GGCATTGAAAAAATTATCCATGG No data
1201446311_1201446312 0 Left 1201446311 Y:14059603-14059625 CCGTTCAAGCTCTGCATGTCACG No data
Right 1201446312 Y:14059626-14059648 ACAGTCTGTGATGATTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201446311 Original CRISPR CGTGACATGCAGAGCTTGAA CGG (reversed) Intergenic
No off target data available for this crispr