ID: 1201446311 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:14059603-14059625 |
| Sequence | CGTGACATGCAGAGCTTGAA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201446311_1201446313 | 21 | Left | 1201446311 | Y:14059603-14059625 | CCGTTCAAGCTCTGCATGTCACG | No data | ||
| Right | 1201446313 | Y:14059647-14059669 | GGCATTGAAAAAATTATCCATGG | No data | ||||
| 1201446311_1201446312 | 0 | Left | 1201446311 | Y:14059603-14059625 | CCGTTCAAGCTCTGCATGTCACG | No data | ||
| Right | 1201446312 | Y:14059626-14059648 | ACAGTCTGTGATGATTCTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201446311 | Original CRISPR | CGTGACATGCAGAGCTTGAA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||