ID: 1201447002

View in Genome Browser
Species Human (GRCh38)
Location Y:14068225-14068247
Sequence GAGTCTTATTTTAAGTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201447002_1201447005 11 Left 1201447002 Y:14068225-14068247 CCAACAGACTTAAAATAAGACTC No data
Right 1201447005 Y:14068259-14068281 AATAACTTCTCTAACATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201447002 Original CRISPR GAGTCTTATTTTAAGTCTGT TGG (reversed) Intergenic
No off target data available for this crispr