ID: 1201448387

View in Genome Browser
Species Human (GRCh38)
Location Y:14083126-14083148
Sequence GTTTACTTCTGGACAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448387_1201448392 -7 Left 1201448387 Y:14083126-14083148 CCAGAACCTGTCCAGAAGTAAAC No data
Right 1201448392 Y:14083142-14083164 AGTAAACTTACCTGGCAAAAGGG No data
1201448387_1201448391 -8 Left 1201448387 Y:14083126-14083148 CCAGAACCTGTCCAGAAGTAAAC No data
Right 1201448391 Y:14083141-14083163 AAGTAAACTTACCTGGCAAAAGG No data
1201448387_1201448394 20 Left 1201448387 Y:14083126-14083148 CCAGAACCTGTCCAGAAGTAAAC No data
Right 1201448394 Y:14083169-14083191 TGTAGATGTGATTACGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448387 Original CRISPR GTTTACTTCTGGACAGGTTC TGG (reversed) Intergenic
No off target data available for this crispr