ID: 1201448502

View in Genome Browser
Species Human (GRCh38)
Location Y:14084077-14084099
Sequence GTCAGAACCACCATCCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448502_1201448510 -1 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448510 Y:14084099-14084121 CCTATCAGCTGGGGTTGGGGAGG No data
1201448502_1201448506 -6 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448506 Y:14084094-14084116 TCTGACCTATCAGCTGGGGTTGG No data
1201448502_1201448508 -4 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448508 Y:14084096-14084118 TGACCTATCAGCTGGGGTTGGGG No data
1201448502_1201448507 -5 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448507 Y:14084095-14084117 CTGACCTATCAGCTGGGGTTGGG No data
1201448502_1201448512 21 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448512 Y:14084121-14084143 GCTGCCTGAAGGTCACCCTTAGG No data
1201448502_1201448511 10 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448511 Y:14084110-14084132 GGGTTGGGGAGGCTGCCTGAAGG No data
1201448502_1201448505 -10 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448505 Y:14084090-14084112 TGGTTCTGACCTATCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448502 Original CRISPR GTCAGAACCACCATCCCCCA TGG (reversed) Intergenic
No off target data available for this crispr