ID: 1201448505

View in Genome Browser
Species Human (GRCh38)
Location Y:14084090-14084112
Sequence TGGTTCTGACCTATCAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448502_1201448505 -10 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448505 Y:14084090-14084112 TGGTTCTGACCTATCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448505 Original CRISPR TGGTTCTGACCTATCAGCTG GGG Intergenic
No off target data available for this crispr