ID: 1201448507

View in Genome Browser
Species Human (GRCh38)
Location Y:14084095-14084117
Sequence CTGACCTATCAGCTGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448502_1201448507 -5 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448507 Y:14084095-14084117 CTGACCTATCAGCTGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448507 Original CRISPR CTGACCTATCAGCTGGGGTT GGG Intergenic
No off target data available for this crispr