ID: 1201448508

View in Genome Browser
Species Human (GRCh38)
Location Y:14084096-14084118
Sequence TGACCTATCAGCTGGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448502_1201448508 -4 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448508 Y:14084096-14084118 TGACCTATCAGCTGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448508 Original CRISPR TGACCTATCAGCTGGGGTTG GGG Intergenic
No off target data available for this crispr