ID: 1201448512

View in Genome Browser
Species Human (GRCh38)
Location Y:14084121-14084143
Sequence GCTGCCTGAAGGTCACCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201448509_1201448512 -1 Left 1201448509 Y:14084099-14084121 CCTATCAGCTGGGGTTGGGGAGG No data
Right 1201448512 Y:14084121-14084143 GCTGCCTGAAGGTCACCCTTAGG No data
1201448502_1201448512 21 Left 1201448502 Y:14084077-14084099 CCATGGGGGATGGTGGTTCTGAC No data
Right 1201448512 Y:14084121-14084143 GCTGCCTGAAGGTCACCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201448512 Original CRISPR GCTGCCTGAAGGTCACCCTT AGG Intergenic
No off target data available for this crispr