ID: 1201460190

View in Genome Browser
Species Human (GRCh38)
Location Y:14213904-14213926
Sequence TCTGGGGGTCTGAAGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201460190_1201460200 10 Left 1201460190 Y:14213904-14213926 CCTTGATCCTTCAGACCCCCAGA No data
Right 1201460200 Y:14213937-14213959 TTCCTCAGTCCCTAAACTCAGGG No data
1201460190_1201460199 9 Left 1201460190 Y:14213904-14213926 CCTTGATCCTTCAGACCCCCAGA No data
Right 1201460199 Y:14213936-14213958 GTTCCTCAGTCCCTAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201460190 Original CRISPR TCTGGGGGTCTGAAGGATCA AGG (reversed) Intergenic
No off target data available for this crispr