ID: 1201462607

View in Genome Browser
Species Human (GRCh38)
Location Y:14243381-14243403
Sequence AGTCATGTGCAGGTTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201462607_1201462613 27 Left 1201462607 Y:14243381-14243403 CCTTTTAAAACCTGCACATGACT No data
Right 1201462613 Y:14243431-14243453 CAACATAGTATTGGAAGTTCTGG 0: 1942
1: 10957
2: 4419
3: 1703
4: 927
1201462607_1201462612 18 Left 1201462607 Y:14243381-14243403 CCTTTTAAAACCTGCACATGACT No data
Right 1201462612 Y:14243422-14243444 ACTGCTATTCAACATAGTATTGG 0: 43
1: 2367
2: 11883
3: 8126
4: 5106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201462607 Original CRISPR AGTCATGTGCAGGTTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr