ID: 1201464958

View in Genome Browser
Species Human (GRCh38)
Location Y:14270261-14270283
Sequence TGGGAAGTCCTGAGACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201464958_1201464970 21 Left 1201464958 Y:14270261-14270283 CCACCATGTCTCAGGACTTCCCA No data
Right 1201464970 Y:14270305-14270327 TGACAGACAACCTCCCAGAAGGG No data
1201464958_1201464966 -3 Left 1201464958 Y:14270261-14270283 CCACCATGTCTCAGGACTTCCCA No data
Right 1201464966 Y:14270281-14270303 CCAGAAGGGGGTCCCAGAAGAGG No data
1201464958_1201464969 20 Left 1201464958 Y:14270261-14270283 CCACCATGTCTCAGGACTTCCCA No data
Right 1201464969 Y:14270304-14270326 CTGACAGACAACCTCCCAGAAGG No data
1201464958_1201464971 22 Left 1201464958 Y:14270261-14270283 CCACCATGTCTCAGGACTTCCCA No data
Right 1201464971 Y:14270306-14270328 GACAGACAACCTCCCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201464958 Original CRISPR TGGGAAGTCCTGAGACATGG TGG (reversed) Intergenic
No off target data available for this crispr