ID: 1201465003

View in Genome Browser
Species Human (GRCh38)
Location Y:14270578-14270600
Sequence CTTCAGATGGGGTTCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201465003_1201465008 1 Left 1201465003 Y:14270578-14270600 CCACTCAAGAACCCCATCTGAAG No data
Right 1201465008 Y:14270602-14270624 TCACCAACATCAAAAATCAAAGG No data
1201465003_1201465010 22 Left 1201465003 Y:14270578-14270600 CCACTCAAGAACCCCATCTGAAG No data
Right 1201465010 Y:14270623-14270645 GGTAGATAAATCCATGAAGTTGG No data
1201465003_1201465011 23 Left 1201465003 Y:14270578-14270600 CCACTCAAGAACCCCATCTGAAG No data
Right 1201465011 Y:14270624-14270646 GTAGATAAATCCATGAAGTTGGG No data
1201465003_1201465012 24 Left 1201465003 Y:14270578-14270600 CCACTCAAGAACCCCATCTGAAG No data
Right 1201465012 Y:14270625-14270647 TAGATAAATCCATGAAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201465003 Original CRISPR CTTCAGATGGGGTTCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr