ID: 1201465547

View in Genome Browser
Species Human (GRCh38)
Location Y:14276333-14276355
Sequence CAGGATAATTACATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5776
Summary {0: 1, 1: 0, 2: 0, 3: 172, 4: 5603}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201465544_1201465547 -4 Left 1201465544 Y:14276314-14276336 CCTACTCAGGAGGCTGAGGCAGG 0: 828
1: 2151
2: 3134
3: 2863
4: 3286
Right 1201465547 Y:14276333-14276355 CAGGATAATTACATGGAACCAGG 0: 1
1: 0
2: 0
3: 172
4: 5603
1201465543_1201465547 -1 Left 1201465543 Y:14276311-14276333 CCACCTACTCAGGAGGCTGAGGC 0: 847
1: 90014
2: 196241
3: 231029
4: 156455
Right 1201465547 Y:14276333-14276355 CAGGATAATTACATGGAACCAGG 0: 1
1: 0
2: 0
3: 172
4: 5603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201465547 Original CRISPR CAGGATAATTACATGGAACC AGG Intergenic
Too many off-targets to display for this crispr