ID: 1201465547 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:14276333-14276355 |
| Sequence | CAGGATAATTACATGGAACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5776 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 172, 4: 5603} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201465544_1201465547 | -4 | Left | 1201465544 | Y:14276314-14276336 | CCTACTCAGGAGGCTGAGGCAGG | 0: 828 1: 2151 2: 3134 3: 2863 4: 3286 |
||
| Right | 1201465547 | Y:14276333-14276355 | CAGGATAATTACATGGAACCAGG | 0: 1 1: 0 2: 0 3: 172 4: 5603 |
||||
| 1201465543_1201465547 | -1 | Left | 1201465543 | Y:14276311-14276333 | CCACCTACTCAGGAGGCTGAGGC | 0: 847 1: 90014 2: 196241 3: 231029 4: 156455 |
||
| Right | 1201465547 | Y:14276333-14276355 | CAGGATAATTACATGGAACCAGG | 0: 1 1: 0 2: 0 3: 172 4: 5603 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201465547 | Original CRISPR | CAGGATAATTACATGGAACC AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||