ID: 1201468312

View in Genome Browser
Species Human (GRCh38)
Location Y:14309318-14309340
Sequence TCATGCTGGCCTGCAAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201468312_1201468319 0 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468319 Y:14309341-14309363 GTTCCAGGTGGGCGTGGGCTCGG 0: 92
1: 754
2: 595
3: 338
4: 386
1201468312_1201468323 25 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468323 Y:14309366-14309388 GGCCCCGCACTCCAAGCGGTCGG No data
1201468312_1201468317 -6 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468317 Y:14309335-14309357 GCATGAGTTCCAGGTGGGCGTGG No data
1201468312_1201468327 29 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468327 Y:14309370-14309392 CCGCACTCCAAGCGGTCGGCTGG No data
1201468312_1201468318 -5 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468318 Y:14309336-14309358 CATGAGTTCCAGGTGGGCGTGGG No data
1201468312_1201468321 4 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468321 Y:14309345-14309367 CAGGTGGGCGTGGGCTCGGCAGG 0: 16
1: 141
2: 620
3: 623
4: 639
1201468312_1201468322 21 Left 1201468312 Y:14309318-14309340 CCGGTGCTTGCAGGCCAGCATGA No data
Right 1201468322 Y:14309362-14309384 GGCAGGCCCCGCACTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201468312 Original CRISPR TCATGCTGGCCTGCAAGCAC CGG (reversed) Intergenic
No off target data available for this crispr