ID: 1201471646

View in Genome Browser
Species Human (GRCh38)
Location Y:14341571-14341593
Sequence CAGTAGCCCTTCAAAATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201471646_1201471652 7 Left 1201471646 Y:14341571-14341593 CCTCCAATTTTGAAGGGCTACTG No data
Right 1201471652 Y:14341601-14341623 AGGGTTAGGCTGGCTTTATAAGG No data
1201471646_1201471651 -3 Left 1201471646 Y:14341571-14341593 CCTCCAATTTTGAAGGGCTACTG No data
Right 1201471651 Y:14341591-14341613 CTGTTGCTAAAGGGTTAGGCTGG No data
1201471646_1201471650 -7 Left 1201471646 Y:14341571-14341593 CCTCCAATTTTGAAGGGCTACTG No data
Right 1201471650 Y:14341587-14341609 GCTACTGTTGCTAAAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201471646 Original CRISPR CAGTAGCCCTTCAAAATTGG AGG (reversed) Intergenic
No off target data available for this crispr