ID: 1201477598

View in Genome Browser
Species Human (GRCh38)
Location Y:14399972-14399994
Sequence CTAGTATTTCAGAGGTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201477595_1201477598 8 Left 1201477595 Y:14399941-14399963 CCAGGAAAAGTTTAGGACAAGAG No data
Right 1201477598 Y:14399972-14399994 CTAGTATTTCAGAGGTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201477598 Original CRISPR CTAGTATTTCAGAGGTAACC AGG Intergenic
No off target data available for this crispr