ID: 1201477844

View in Genome Browser
Species Human (GRCh38)
Location Y:14403295-14403317
Sequence GCCATCGCCCTGATGATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201477844_1201477849 4 Left 1201477844 Y:14403295-14403317 CCTCCTATCATCAGGGCGATGGC No data
Right 1201477849 Y:14403322-14403344 GGATTGTAATAAGAGGAGCAGGG No data
1201477844_1201477848 3 Left 1201477844 Y:14403295-14403317 CCTCCTATCATCAGGGCGATGGC No data
Right 1201477848 Y:14403321-14403343 TGGATTGTAATAAGAGGAGCAGG No data
1201477844_1201477847 -3 Left 1201477844 Y:14403295-14403317 CCTCCTATCATCAGGGCGATGGC No data
Right 1201477847 Y:14403315-14403337 GGCATGTGGATTGTAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201477844 Original CRISPR GCCATCGCCCTGATGATAGG AGG (reversed) Intergenic
No off target data available for this crispr