ID: 1201484531

View in Genome Browser
Species Human (GRCh38)
Location Y:14478231-14478253
Sequence CTGGAGGCTTATATGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201484531_1201484537 9 Left 1201484531 Y:14478231-14478253 CCCCTCCACATATAAGCCTCCAG No data
Right 1201484537 Y:14478263-14478285 CAGCCTAGCTACCCCCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201484531 Original CRISPR CTGGAGGCTTATATGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr