ID: 1201489447

View in Genome Browser
Species Human (GRCh38)
Location Y:14524780-14524802
Sequence CACCGCGGAGTGGAAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201489447_1201489457 21 Left 1201489447 Y:14524780-14524802 CCTGCGCCTTCCACTCCGCGGTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1201489457 Y:14524824-14524846 CCAGGAGGCCGATCTACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 93
1201489447_1201489453 3 Left 1201489447 Y:14524780-14524802 CCTGCGCCTTCCACTCCGCGGTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1201489453 Y:14524806-14524828 CTCTCTGCCTGCGGTTTTCCAGG 0: 1
1: 0
2: 3
3: 16
4: 219
1201489447_1201489454 6 Left 1201489447 Y:14524780-14524802 CCTGCGCCTTCCACTCCGCGGTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1201489454 Y:14524809-14524831 TCTGCCTGCGGTTTTCCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 150
1201489447_1201489458 22 Left 1201489447 Y:14524780-14524802 CCTGCGCCTTCCACTCCGCGGTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1201489458 Y:14524825-14524847 CAGGAGGCCGATCTACCCCAGGG 0: 1
1: 0
2: 1
3: 18
4: 75
1201489447_1201489452 -6 Left 1201489447 Y:14524780-14524802 CCTGCGCCTTCCACTCCGCGGTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1201489452 Y:14524797-14524819 GCGGTGGCGCTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201489447 Original CRISPR CACCGCGGAGTGGAAGGCGC AGG (reversed) Intronic
901086301 1:6614086-6614108 CACCTCCGGGTGGAAGGCGGCGG - Exonic
901225558 1:7611106-7611128 GACTGTGGAGAGGAAGGCGCGGG + Intronic
901625889 1:10624868-10624890 CACTGCGGTGTGGATGGGGCTGG - Intronic
902044205 1:13513210-13513232 CCCGGCCGAGCGGAAGGCGCCGG + Exonic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
905173928 1:36124938-36124960 CACCCCGGAGTCCGAGGCGCCGG + Intronic
905847124 1:41242256-41242278 CACCTCGCAGCGGGAGGCGCGGG - Intergenic
907102206 1:51847468-51847490 CACGGCGGGGTGGGAGGCTCAGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
924940892 1:248811954-248811976 GAACGCGGAGTGGAGGGCGCCGG - Exonic
1063357243 10:5412727-5412749 GACCGCGGAGGCGAAGCCGCCGG + Exonic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064568937 10:16672343-16672365 CACCTAGGAGTGGAATGCGTGGG - Intronic
1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG + Intronic
1066654917 10:37688155-37688177 CACCATGGGGTGGAAGGGGCTGG - Intergenic
1067039873 10:42943625-42943647 CACCACGGGGTGGAAGGGGCTGG - Intergenic
1070997282 10:80796889-80796911 CACAGCAAGGTGGAAGGCGCTGG - Intergenic
1071049392 10:81428135-81428157 CACAGTGGAGTGGAACGGGCAGG - Intergenic
1075007645 10:118842262-118842284 CTCCGTGGAGTGGGAGGCCCAGG - Intergenic
1075599885 10:123759774-123759796 CACCGTGGAGGAGAAGGTGCAGG + Intronic
1083629696 11:64089220-64089242 CACCGCGGAGGTGAGGGCCCCGG + Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1097747668 12:63317628-63317650 CACCTGGGAGTGGAGGGGGCGGG + Intergenic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1103721670 12:122978684-122978706 CACCGTGGAGTGGAAGCCCAGGG + Intronic
1103954220 12:124567494-124567516 CATCGCGGAGCGCAGGGCGCGGG + Intronic
1104506532 12:129337576-129337598 CTCGGGGGAGGGGAAGGCGCCGG - Intronic
1104869718 12:131986390-131986412 CATCGTGGAGCGGAAGGTGCTGG + Intronic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1108733370 13:53257540-53257562 CCCTGGGGAGTGGAAGGGGCAGG - Intergenic
1110450861 13:75636287-75636309 CACCGCGGGGAGGACGGCGGCGG + Intronic
1112323699 13:98429440-98429462 CACAGTGAAGTGGAAGGGGCTGG + Intronic
1113769369 13:112898582-112898604 CACCGGGGAGGGAAGGGCGCTGG - Intronic
1114612552 14:24052245-24052267 CACCACGGGGAGGAACGCGCTGG - Intronic
1116733171 14:48651784-48651806 TACCTAGGAGTGGAAGGCGTGGG - Intergenic
1118797149 14:69153430-69153452 CTCCGCGGAGTGCGGGGCGCTGG - Intergenic
1118854615 14:69611543-69611565 CCCCGCGGAGGGGAGGGGGCGGG - Intergenic
1119262282 14:73244936-73244958 CAGCTCAGAGTGGAAGGCCCTGG - Intronic
1123017540 14:105382560-105382582 CACCTCGGACTGGCAGGGGCAGG + Exonic
1125833638 15:42732890-42732912 CACCTGTGAGTGGAAGGAGCTGG + Intronic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1129928321 15:79385578-79385600 CTCCCTGGAGTGGAAGGCCCAGG + Intronic
1133340605 16:5033430-5033452 CACCGTGGAGGAGACGGCGCGGG - Exonic
1138659903 16:58510734-58510756 CACTGCGCAGAGGAAGGAGCGGG - Intronic
1139505127 16:67394793-67394815 CGACGCCGAGTGGTAGGCGCCGG + Exonic
1142763440 17:2053946-2053968 CACCGCGGAGCGCGAGGGGCTGG - Intergenic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148783776 17:50135435-50135457 CACCGGGGGGCGGAAGGGGCTGG - Intronic
1151175484 17:72284479-72284501 CATAGAGGAGTGGAAGGCACAGG + Intergenic
1154294476 18:13136957-13136979 GAGCGCGGAGGGGAAGGTGCGGG - Intergenic
1160358663 18:78250943-78250965 CACTCCGGAGTGGAAAGCGTGGG + Intergenic
1161956884 19:7501081-7501103 CACGGCGGCGTGGATGGCGGCGG - Exonic
1162141000 19:8585551-8585573 TGCCGCGGAGGAGAAGGCGCTGG - Exonic
1162773629 19:12965555-12965577 CTCCGTGGAGGGGAGGGCGCGGG + Intronic
1163569053 19:18069506-18069528 CACAGAGGAGGGGTAGGCGCAGG + Intronic
929563398 2:42969639-42969661 CACAGCCGACTGGAAGGGGCAGG + Intergenic
937203960 2:120223895-120223917 CACTCCAGAGTGGAAGGTGCTGG + Intergenic
937320704 2:120959050-120959072 CACAGGGGACTGGAAGGGGCTGG + Intronic
942302029 2:174571906-174571928 GGCCGCGGAGTGGAAGGCACTGG + Exonic
947754228 2:232550402-232550424 CACCGCGTCGTTGACGGCGCGGG - Exonic
948652496 2:239457193-239457215 CACCAGGGAGTGGAAGGTGTGGG + Intergenic
948915553 2:241033530-241033552 CTCTGCTGAGTGGCAGGCGCTGG + Intronic
1170893799 20:20396560-20396582 CCCCGGGGAGGGGAAGGCCCAGG + Intronic
1171043758 20:21791112-21791134 CACAGCAGAGCGGAAGGGGCAGG + Intergenic
1171361679 20:24590475-24590497 CAGGGCGGAGGGGGAGGCGCAGG + Intronic
1175114744 20:56674087-56674109 CAGTGAGGAGTGGAAGGGGCCGG + Intergenic
1176247160 20:64102718-64102740 CACCGCGGGGTGGGGGGCGGAGG - Intergenic
1176377835 21:6095571-6095593 CCACGCGGAGTGGAGGGGGCAGG + Intergenic
1179745639 21:43442677-43442699 CCACGCGGAGTGGAGGGGGCAGG - Intergenic
1184192137 22:42901917-42901939 CACCACGGAGAGGAAGGGCCAGG - Intronic
1185346250 22:50312077-50312099 CACTGGGGAGTGGGAGGCTCAGG + Exonic
950282299 3:11719172-11719194 GACCGCGGGGTGCCAGGCGCGGG + Intronic
954251495 3:49371096-49371118 CACCGTGGGGTGGAGGGGGCCGG - Intronic
954456605 3:50603064-50603086 CACAGTGAAGTGGAAGGCGAGGG - Intergenic
955348480 3:58177933-58177955 CCCTGCGGTGGGGAAGGCGCGGG + Intergenic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
968052595 3:195665544-195665566 CACCGCAGAAAGGTAGGCGCCGG - Intergenic
968301524 3:197620388-197620410 CACCGCAGAAAGGTAGGCGCCGG + Intergenic
968434024 4:575895-575917 CAGCCCGGAGTAGAAGGCGCCGG + Intergenic
968534094 4:1113003-1113025 CACCGGGGAGTGGGGGCCGCGGG - Intronic
981748352 4:148071731-148071753 CACAGTGGATTGGAAGGGGCCGG + Intronic
982197403 4:152930155-152930177 CACCACTGTGTGGAAGGCACAGG - Intergenic
984639015 4:182143378-182143400 CACTGTGGAAAGGAAGGCGCGGG + Intergenic
985498848 5:227662-227684 CACCGCAGAAAGGTAGGCGCCGG - Intronic
988785589 5:34563409-34563431 CAGGGCGGAGAGGAAGGCGGTGG - Intergenic
996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG + Exonic
1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG + Exonic
1002524342 5:179806968-179806990 CGCCGCGGAGTCGACGGCGCAGG + Intronic
1003558570 6:7162414-7162436 CACCACTGAGTGCAAGGCGAGGG - Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1017124411 6:151052019-151052041 CGCAGTGGAGTGGAAGTCGCCGG + Intronic
1017737934 6:157381000-157381022 CCCTGGGGTGTGGAAGGCGCGGG - Intergenic
1019269956 7:141434-141456 CACAGCTGAGTGGAAGGAGCTGG + Intergenic
1020001804 7:4760391-4760413 CACCGCGGAGAGGAAGTCCAGGG - Intronic
1024260201 7:47568621-47568643 CACCGCAGAGTGGAGGCCGCAGG - Intronic
1027250045 7:76393341-76393363 CACTGCGGCGTGGGAGGGGCGGG - Intronic
1032781876 7:135170423-135170445 GAGTGCGGAGCGGAAGGCGCGGG + Intronic
1034569067 7:151940739-151940761 CAGGGCGGAGTGGGGGGCGCTGG + Intergenic
1038644387 8:29350511-29350533 CAGAGCGGAGGGGGAGGCGCCGG + Exonic
1040481814 8:47833582-47833604 CACCGAGCAGAGGAAGGCACGGG - Intronic
1049776765 8:144409536-144409558 CAGCGCGGGTTGGAAGCCGCAGG + Intergenic
1060472356 9:123958805-123958827 CACTGCAGAGTGGAAGGCAGAGG - Intergenic
1062306138 9:135907881-135907903 CAGCGGGGAGTGGGCGGCGCGGG + Intergenic
1062362102 9:136193080-136193102 CCCCGCGGAGCGGGAGGTGCGGG - Intergenic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1191148175 X:57190658-57190680 CACCCGGGAGTGCAAGGAGCGGG - Intergenic
1195881732 X:109600244-109600266 CAGCGCGGAGAGGCAGGCGCGGG + Intergenic
1198694477 X:139321072-139321094 CACGGCGGAGGGGGAGGCTCAGG - Intergenic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic