ID: 1201491819

View in Genome Browser
Species Human (GRCh38)
Location Y:14549905-14549927
Sequence CCCAGGGAAGTCTCCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201491819_1201491829 19 Left 1201491819 Y:14549905-14549927 CCAACAGTGGAGACTTCCCTGGG No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491819_1201491828 18 Left 1201491819 Y:14549905-14549927 CCAACAGTGGAGACTTCCCTGGG No data
Right 1201491828 Y:14549946-14549968 CCTAATGAGCTTCCTGCCTGTGG No data
1201491819_1201491830 20 Left 1201491819 Y:14549905-14549927 CCAACAGTGGAGACTTCCCTGGG No data
Right 1201491830 Y:14549948-14549970 TAATGAGCTTCCTGCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201491819 Original CRISPR CCCAGGGAAGTCTCCACTGT TGG (reversed) Intronic