ID: 1201491829

View in Genome Browser
Species Human (GRCh38)
Location Y:14549947-14549969
Sequence CTAATGAGCTTCCTGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201491823_1201491829 -5 Left 1201491823 Y:14549929-14549951 CCTTCACCCCATCTGCTCCTAAT No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491822_1201491829 2 Left 1201491822 Y:14549922-14549944 CCTGGGACCTTCACCCCATCTGC No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491821_1201491829 3 Left 1201491821 Y:14549921-14549943 CCCTGGGACCTTCACCCCATCTG No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491819_1201491829 19 Left 1201491819 Y:14549905-14549927 CCAACAGTGGAGACTTCCCTGGG No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491817_1201491829 28 Left 1201491817 Y:14549896-14549918 CCAGAAGCTCCAACAGTGGAGAC No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data
1201491816_1201491829 29 Left 1201491816 Y:14549895-14549917 CCCAGAAGCTCCAACAGTGGAGA No data
Right 1201491829 Y:14549947-14549969 CTAATGAGCTTCCTGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201491829 Original CRISPR CTAATGAGCTTCCTGCCTGT GGG Intronic