ID: 1201496324

View in Genome Browser
Species Human (GRCh38)
Location Y:14594223-14594245
Sequence ATGATCCAACAGAAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 10, 3: 273, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201496324_1201496337 20 Left 1201496324 Y:14594223-14594245 CCTCATTCCTTCTGTTGGATCAT 0: 1
1: 0
2: 10
3: 273
4: 305
Right 1201496337 Y:14594266-14594288 CAGGGAAACTTCATCCTCTGGGG 0: 3
1: 14
2: 20
3: 41
4: 553
1201496324_1201496332 2 Left 1201496324 Y:14594223-14594245 CCTCATTCCTTCTGTTGGATCAT 0: 1
1: 0
2: 10
3: 273
4: 305
Right 1201496332 Y:14594248-14594270 GGTTGGGGGCTTCTGACCCAGGG 0: 21
1: 10
2: 3
3: 26
4: 204
1201496324_1201496336 19 Left 1201496324 Y:14594223-14594245 CCTCATTCCTTCTGTTGGATCAT 0: 1
1: 0
2: 10
3: 273
4: 305
Right 1201496336 Y:14594265-14594287 CCAGGGAAACTTCATCCTCTGGG 0: 3
1: 16
2: 19
3: 37
4: 275
1201496324_1201496334 18 Left 1201496324 Y:14594223-14594245 CCTCATTCCTTCTGTTGGATCAT 0: 1
1: 0
2: 10
3: 273
4: 305
Right 1201496334 Y:14594264-14594286 CCCAGGGAAACTTCATCCTCTGG 0: 3
1: 18
2: 17
3: 30
4: 261
1201496324_1201496331 1 Left 1201496324 Y:14594223-14594245 CCTCATTCCTTCTGTTGGATCAT 0: 1
1: 0
2: 10
3: 273
4: 305
Right 1201496331 Y:14594247-14594269 TGGTTGGGGGCTTCTGACCCAGG 0: 25
1: 10
2: 3
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201496324 Original CRISPR ATGATCCAACAGAAGGAATG AGG (reversed) Intronic
900826488 1:4931196-4931218 AAAATCCAACACAATGAATGAGG - Intergenic
901842604 1:11963620-11963642 CTGATCCAACAGAACAAGTGAGG + Exonic
903498617 1:23789438-23789460 ATGATCCAACTGAAATAAAGAGG - Intergenic
904217535 1:28934805-28934827 ATTATCCAATAAAAGGAATGGGG - Intronic
904703279 1:32371754-32371776 AGGATACCATAGAAGGAATGTGG - Intronic
904905463 1:33894501-33894523 ATTATCCCACCCAAGGAATGAGG - Intronic
905950435 1:41946282-41946304 ATGATCCAGCAGCAGGACTGAGG + Intronic
906507202 1:46389017-46389039 ATGATCCAGCAGCAGGACTGAGG - Intergenic
906583475 1:46955643-46955665 GTGATCCAGCAGAAGGACTGAGG + Intergenic
906766789 1:48441167-48441189 ATGATCCAACAACAGGACTGAGG + Intronic
907037431 1:51228900-51228922 ATGATCCAGCAGCAGGACTGAGG + Intergenic
907505551 1:54915468-54915490 ATGATCCAGCAGCAGGACTGAGG - Intergenic
907602482 1:55784994-55785016 ATGATCCAGCAGCAGGACTGAGG - Intergenic
907842456 1:58170816-58170838 ATGATCCAACAACAGGACTGAGG + Intronic
908300518 1:62757442-62757464 ATGATCCAACAACAGGATTGAGG + Intergenic
908431213 1:64060338-64060360 ATTATCCAACAGAAGAACTCTGG - Intronic
908659667 1:66422985-66423007 ATGATCCAACAATATGACTGAGG - Intergenic
909549722 1:76884222-76884244 ATTCTCCAACAGAAGGTTTGTGG + Intronic
910591081 1:88928636-88928658 ATGATCCAGCAGCAGGACTGAGG + Intergenic
910656846 1:89628621-89628643 ATGATCCAGCAAGGGGAATGGGG + Intergenic
911072412 1:93842691-93842713 TTGATTCAAGATAAGGAATGTGG - Intronic
911129663 1:94375639-94375661 ATGATCCAGCAAAAGGACTGAGG - Intergenic
911299078 1:96151090-96151112 ATGATCCAACAACAGGACTGAGG + Intergenic
911845509 1:102746922-102746944 ATTATCCAACAATAGGATTGAGG - Intergenic
912021406 1:105112200-105112222 ATGATCCAACAACAGGACTGAGG + Intergenic
912108117 1:106306400-106306422 AGGAGCCCACAGTAGGAATGGGG - Intergenic
912463872 1:109855886-109855908 ATGATCCAGCAGCAGGACTGAGG - Intergenic
913382729 1:118228716-118228738 ATGATTCAACAATAGGACTGAGG + Intergenic
913469630 1:119175478-119175500 ATGATCCAACAACAGGACTGAGG + Intergenic
913470416 1:119180565-119180587 ATGATCCAGCAGCAGGACTGAGG - Intergenic
913713606 1:121511718-121511740 ATGATGCAACAACAGGATTGAGG + Intergenic
915199958 1:154220302-154220324 AAGATGCGACAGCAGGAATGGGG + Intronic
915254539 1:154616346-154616368 ATGGTCCAACAGAAGGGAGAAGG - Intronic
915260674 1:154674669-154674691 ATGATCCATCAACAGGACTGAGG + Intergenic
915307527 1:154989249-154989271 AAGAGCCAACAGTATGAATGAGG + Intronic
915868853 1:159536117-159536139 ATGATCAAAAAGAAGGAAATTGG - Intergenic
916083783 1:161253589-161253611 ATGATCCAACAACAGGACTGAGG + Intergenic
916114542 1:161475746-161475768 ATGATCCAACAACAGGACTGAGG + Intergenic
916939632 1:169665189-169665211 ATGATCCAACAACAGGACTGAGG + Intronic
917086235 1:171308031-171308053 ATGATCCAACAACAGGACTGAGG + Intergenic
917227677 1:172801573-172801595 ATGATCCAACAACAGGACTGAGG + Intergenic
917279989 1:173371038-173371060 ATGATCCAACAACAGGACTGAGG + Intergenic
917445685 1:175104336-175104358 ATGATCCAACAACAGGACTGAGG - Intronic
917676378 1:177322786-177322808 ATGATCCAACAATAGGACTGAGG + Intergenic
918393543 1:184091196-184091218 ATGATCCAAAAGAAGGAGAAGGG + Intergenic
918690772 1:187476252-187476274 GAGATCTAACAGAAGCAATGAGG + Intergenic
918750074 1:188260547-188260569 ATGATCCAACAACAGGACTGAGG - Intergenic
919206386 1:194425174-194425196 ATGATCCAACAACAGGACTGAGG + Intergenic
920425166 1:205869209-205869231 ATGATCCAGCAGCAGGACTGAGG - Intergenic
921019807 1:211225367-211225389 ATGATCTAACAATAGGACTGAGG + Intergenic
921092693 1:211858426-211858448 ATGATCCAGCAGCAGGACTGAGG + Intergenic
922684641 1:227629677-227629699 ATGATCCAGCAGCAGGAATGAGG - Intronic
923074198 1:230594849-230594871 AAGATCAAAAAGAAGGAATGGGG + Intergenic
923428849 1:233900406-233900428 AAGAGACAACATAAGGAATGAGG + Intergenic
1063321593 10:5057059-5057081 ATGATCCAACAATAGGACTGAGG - Intronic
1063414917 10:5865350-5865372 ATGATCCAACAACAGGACCGAGG + Intronic
1063711377 10:8482488-8482510 AGGATGCCTCAGAAGGAATGTGG - Intergenic
1064603455 10:17015665-17015687 ATGATCCAACAACAGGACTGAGG - Intronic
1065082530 10:22141976-22141998 ATGATCCAACAATATGACTGAGG + Intergenic
1065159520 10:22904984-22905006 AGAATCCCACAGAAGGGATGAGG - Intergenic
1065199564 10:23300111-23300133 ATGATCGAGCAGCAGGACTGAGG - Intronic
1065472105 10:26092718-26092740 AAGATCCACAAGTAGGAATGAGG + Intronic
1065507563 10:26444497-26444519 ATTTCCCGACAGAAGGAATGTGG + Intronic
1065537493 10:26729253-26729275 ATTTTCCACCAAAAGGAATGTGG - Intronic
1065677006 10:28187031-28187053 ATGCTCTACCAGAATGAATGTGG - Intronic
1066614465 10:37281471-37281493 ATGATCCAACAACAGGATTGAGG - Intronic
1067218290 10:44322067-44322089 CTTATCCAACAGAAGCACTGGGG + Intergenic
1068240766 10:54298647-54298669 ATGATCCAACAACAGGACTGAGG + Intronic
1068500424 10:57835859-57835881 ATGATCCAACAACAGGACTGAGG + Intergenic
1068791772 10:61037386-61037408 ATGATCCAGCAGCAGGACAGAGG - Intergenic
1069137232 10:64781639-64781661 ATGATCCACCAACAGGACTGAGG - Intergenic
1069154818 10:65015065-65015087 ATGATCTAACAGAAACAATGAGG + Intergenic
1069307238 10:66985703-66985725 ATAAACAAACAGAAAGAATGTGG - Intronic
1069364980 10:67687258-67687280 ATGATCCAACAACAGGACTGAGG - Intronic
1070689114 10:78511654-78511676 ATGACCCAACAGGAGGAACAGGG + Intergenic
1071326971 10:84527373-84527395 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1071747909 10:88442756-88442778 ATGATCAATCAGGAGGACTGTGG - Intronic
1071834974 10:89409538-89409560 ATGATCCAACAACAGGACTGAGG + Intronic
1072371548 10:94770199-94770221 ATGATCCAACAACAGGACTCAGG - Intronic
1072378054 10:94837799-94837821 ATGATCCAGCAGCAGGACTGAGG - Intronic
1072471876 10:95720650-95720672 ATGATCCAGCAGCAGGAATGAGG - Intronic
1073572480 10:104592242-104592264 ATGACCTATCAGAAGGCATGCGG - Intergenic
1074552986 10:114462423-114462445 ATGATGAAAAAGAAGGGATGGGG + Intronic
1074613151 10:115040223-115040245 ATGATCCAACCACAGGACTGAGG + Intergenic
1074742540 10:116499263-116499285 ATGATCCAATAACAGGACTGAGG - Intergenic
1075146437 10:119886656-119886678 ATGATCCAACAACAGAACTGAGG + Intronic
1075262333 10:120973996-120974018 TAGAGCCTACAGAAGGAATGTGG - Intergenic
1075747124 10:124735805-124735827 ATACTCCAGAAGAAGGAATGGGG + Intronic
1076431479 10:130406764-130406786 CTGATTCAAAAGAAGGAAAGAGG + Intergenic
1076498751 10:130917532-130917554 ATAATCCAACAGAAGGACCCAGG - Intergenic
1079254908 11:18819462-18819484 ATAATCCAGCAGCAGGACTGAGG - Intergenic
1079731100 11:23938409-23938431 ATGATCCAACAACAGGACTGAGG - Intergenic
1079887198 11:26003451-26003473 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1079906263 11:26251416-26251438 ATAATCCAAAAGGAAGAATGAGG + Intergenic
1079933686 11:26593586-26593608 ATGATCCAGCAGCAGGACTGAGG - Intronic
1081033549 11:38114661-38114683 ATGATCCAACAACAGGACTGAGG + Intergenic
1081070617 11:38605202-38605224 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1081146116 11:39563848-39563870 ATGATCCAACAACAGGACTGAGG + Intergenic
1081421539 11:42878139-42878161 ATGATCCAACAACAGGACTGAGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1084211126 11:67623201-67623223 ACGATCCAACAACAGGACTGAGG + Intergenic
1084752310 11:71212468-71212490 ATGATACAAGAGGAGGAACGAGG - Intronic
1085601722 11:77861525-77861547 ATGATCCAGCAGCAGGACTGAGG - Intronic
1086408826 11:86523092-86523114 AGGAGCCAACAGTAGGACTGAGG - Intronic
1087075111 11:94121351-94121373 ATGATCCAACAACAGGACTGAGG + Intergenic
1087319377 11:96639565-96639587 ATGATCCAACAACAGGACTGAGG + Intergenic
1087458879 11:98421830-98421852 ATGACCCAACAACAGGACTGAGG - Intergenic
1087683223 11:101237494-101237516 ATGATCCAACAACAGGACTGAGG - Intergenic
1088930767 11:114348757-114348779 ATGGTCCAACAACAGGACTGAGG - Intergenic
1090835040 11:130448227-130448249 ATGTTGCAACAGCAGGGATGAGG + Intergenic
1090936945 11:131351678-131351700 TTCAGCCAACAGAAGCAATGCGG + Intergenic
1092469405 12:8764676-8764698 ATGATCCAGCAGCAGGACTGAGG - Intronic
1092472428 12:8791438-8791460 ATGATCCAACAACAGGACTGAGG + Intergenic
1092922560 12:13245640-13245662 ATGATCCAGCAGATGCAATAAGG - Intergenic
1093022899 12:14219530-14219552 ATGGTCCAACAACAGGACTGAGG + Intergenic
1093082396 12:14827846-14827868 ATGATCAAAGAAATGGAATGGGG - Exonic
1093345362 12:18034449-18034471 ATGATCCAACAACAGGACTGAGG + Intergenic
1093348609 12:18070106-18070128 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1093580475 12:20780126-20780148 ATGATCCAACAACAGGACTGAGG - Intergenic
1094319637 12:29171228-29171250 ATGATCCAACAACAGGACTGAGG - Intronic
1094491801 12:30965374-30965396 ATGACCCGACGGAAGGAAGGAGG - Intronic
1094614620 12:32025010-32025032 GTGATCCAAACAAAGGAATGTGG + Intergenic
1095139020 12:38639956-38639978 ATGATCCAGTAGCAGGACTGAGG + Intergenic
1095283973 12:40387732-40387754 ATAATCCAGCAGCAGGACTGAGG + Intergenic
1096352029 12:50908467-50908489 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1096929613 12:55192284-55192306 ATGAACAAAAAGAAGCAATGGGG - Intergenic
1097377215 12:58855540-58855562 ATAATCCAGCAGCAGGACTGAGG - Intergenic
1097428424 12:59474026-59474048 ATGATCCAACAACAGGACTGAGG + Intergenic
1098066539 12:66623683-66623705 CTGAGCCTACAGAAGAAATGAGG - Intronic
1098514322 12:71356839-71356861 ATGATAAAATAGAAAGAATGTGG - Intronic
1099376376 12:81899602-81899624 ATGATCCAACAACAGGACTGAGG + Intergenic
1099414621 12:82371292-82371314 ATGATCCAACAACAGGACTGAGG - Intronic
1099576745 12:84392463-84392485 ATGACCCAACAACAGGACTGAGG - Intergenic
1099605307 12:84795948-84795970 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1100050771 12:90445977-90445999 ATGATCCAACAACAGGACTGAGG - Intergenic
1100209913 12:92389768-92389790 ATGATCCAACAACAGGACTGAGG + Intergenic
1100383607 12:94085079-94085101 ATGATCCAGCAGAACAAATTGGG + Intergenic
1100530102 12:95454841-95454863 ATGATCCAACAACAGGACTGAGG - Intergenic
1100530348 12:95456314-95456336 ATGATCCAACAACAGGAATGAGG - Intergenic
1101705159 12:107214685-107214707 ATGATCCAACAACAGGACTGAGG + Intergenic
1102271516 12:111540166-111540188 ATAAAGCAAGAGAAGGAATGTGG - Intronic
1103803144 12:123552645-123552667 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1104306300 12:127613415-127613437 ATGATCCAACGACAGGACTGAGG + Intergenic
1104767229 12:131338013-131338035 ATGATCCAACAACAGGACTGAGG + Intergenic
1105762608 13:23528006-23528028 ATGATCCGACAACAGGACTGAGG + Intergenic
1106162821 13:27215885-27215907 ATGATCCAACAACAGGACTGAGG + Intergenic
1108876722 13:55057826-55057848 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1109091586 13:58052707-58052729 ATCATCCAAGAGAATGAGTGGGG - Intergenic
1109424537 13:62153058-62153080 ATGATCCAACAACAGGACTGAGG + Intergenic
1109606690 13:64706146-64706168 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1110268544 13:73567478-73567500 CTAATACAGCAGAAGGAATGGGG + Intergenic
1111372642 13:87336658-87336680 ATGATCCAACAACAGAACTGAGG + Intergenic
1111597015 13:90425188-90425210 ATGTGCTAACAGCAGGAATGGGG - Intergenic
1111806229 13:93042950-93042972 CTGATCCAGCAGCAGGACTGAGG + Intergenic
1112519244 13:100081441-100081463 ATGATCCAACAACAGGACTGAGG + Intergenic
1112538499 13:100283960-100283982 ATGATCCAACAACAGGACTGAGG + Intronic
1113100192 13:106709400-106709422 ATGACACCACAGAAGGAATCTGG + Intergenic
1113203805 13:107894146-107894168 ATGATCCAACAACAGGACTGAGG - Intergenic
1114384359 14:22240457-22240479 ATAATCCAGCAGCAGGACTGAGG + Intergenic
1115285337 14:31708773-31708795 ATGATCCAACAACAGGACTGAGG - Intronic
1115723861 14:36191923-36191945 TTGATACAAGAGAAGGAAAGAGG - Intergenic
1117198129 14:53361727-53361749 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1117672478 14:58122876-58122898 ATGATCCAGCAGCAGGACTGAGG + Intronic
1118127787 14:62928201-62928223 ATGATCCTGCAGAAGTCATGCGG + Intronic
1118383469 14:65236677-65236699 ATGACCCAAGAGCAGGGATGAGG + Intergenic
1120198918 14:81516151-81516173 ATGATCCAACAACAGGACTGAGG + Intronic
1122006570 14:98709431-98709453 ATCATCTAACAGAAAGAAAGAGG - Intergenic
1122357624 14:101132921-101132943 TAGATCAAACAGAAGGAAAGGGG + Intergenic
1123812606 15:23943736-23943758 ATGATCCAAGAGATGGAAACAGG + Intergenic
1124169198 15:27357686-27357708 ATGTTGCAACAGATTGAATGCGG - Intronic
1125994886 15:44149120-44149142 ATCAACAACCAGAAGGAATGGGG + Intronic
1126071957 15:44873256-44873278 ATGATCCAACAACAGGACTGAGG - Intergenic
1127074245 15:55310385-55310407 ATGATCCAGCAGCAGGACTGAGG - Intronic
1127308678 15:57731938-57731960 CGGTTCCAAGAGAAGGAATGTGG - Intronic
1128362582 15:66972746-66972768 ATGATCCAGCAGCAGGACAGAGG - Intergenic
1128506923 15:68278876-68278898 ATCTTCCCACAGAGGGAATGAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128769327 15:70270051-70270073 ATTAGCAAACAGAAGTAATGAGG + Intergenic
1131411328 15:92210460-92210482 ATGATCCAACAACAGGACTGAGG + Intergenic
1131604883 15:93891874-93891896 ATGATCCAACAACATGAATTAGG + Intergenic
1132147893 15:99439159-99439181 ATGAACAAACGGAAGAAATGAGG + Intergenic
1132967147 16:2663493-2663515 TTGATCCACAAAAAGGAATGCGG - Intergenic
1135224772 16:20646376-20646398 ATGATCCAGCAGCAGGACTGAGG + Intronic
1135339547 16:21634306-21634328 ATGATCCAACAACAGGATTGAGG - Intronic
1135649273 16:24191573-24191595 TTGAACCAAGAGAAAGAATGAGG - Intronic
1137036259 16:35572513-35572535 ATGCTCCAACACGAGGTATGGGG + Intergenic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1139022604 16:62769018-62769040 AAGAACCAAGAGAATGAATGTGG + Intergenic
1140924547 16:79569903-79569925 ATGATCCATCAGCTGGAATCCGG + Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141108346 16:81251980-81252002 ATGTCCCTTCAGAAGGAATGTGG + Intronic
1144429656 17:15179638-15179660 ATGCTCAAACAGAATGAATTAGG - Intergenic
1146310631 17:31765637-31765659 ATGATTCAACAACAGGACTGAGG + Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147728238 17:42580198-42580220 ATGAGCCAATAGTAAGAATGTGG - Exonic
1148826981 17:50400972-50400994 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1149074018 17:52576351-52576373 ATGATCCAACCACAGGACTGAGG + Intergenic
1149209820 17:54289681-54289703 ATGATCCAAAAACAGGACTGAGG + Intergenic
1151209215 17:72531498-72531520 ATGACCCCTCAGAAGGAATTTGG - Intergenic
1151245893 17:72794375-72794397 GGGACCCAACAGAAGGATTGTGG - Intronic
1151496527 17:74461363-74461385 AACTCCCAACAGAAGGAATGGGG - Intergenic
1151568131 17:74911514-74911536 ATGATCTAACAGCAGGACTGAGG + Intergenic
1153401589 18:4688786-4688808 ATGATCCAGCAGCAGGATTGAGG + Intergenic
1155475998 18:26236464-26236486 ATGATCCAACAACAGGACTGAGG - Intronic
1156822516 18:41389982-41390004 ATCAAACAGCAGAAGGAATGTGG + Intergenic
1157343754 18:46804654-46804676 ATGATTTAATAGAAGTAATGTGG - Intergenic
1157638327 18:49184930-49184952 ATAAAGCTACAGAAGGAATGAGG + Intronic
1157857449 18:51115694-51115716 ATGATCCAACAACAGGACTGAGG - Intergenic
1161598113 19:5162768-5162790 ATGATCCAACAACAGGATTGAGG - Intronic
1162108027 19:8382628-8382650 ATGATCCAACAACAGGACTGAGG + Intronic
1162237321 19:9319542-9319564 ATGATCCAACAACAGGACTGAGG - Intergenic
1163597942 19:18231406-18231428 ATGAGTCACCAGAAGGGATGGGG + Intronic
1163625455 19:18386804-18386826 AGGATCCAAGAGAAACAATGGGG + Intronic
1164083824 19:21883473-21883495 TTGATCCACAAAAAGGAATGCGG - Intergenic
1164173601 19:22748828-22748850 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1164323095 19:24168148-24168170 ATTATCCAGCAGCAGGAATGAGG - Intergenic
1164903151 19:31945495-31945517 ATGATGGAACAGAAGGCAAGAGG - Intergenic
1165847201 19:38825877-38825899 ATGATCCAACAACAGGACAGAGG + Intronic
1166182412 19:41118224-41118246 AGGGACCAACAGAAGGAAGGAGG + Intronic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
925928558 2:8687777-8687799 AAGATGCAACAGAAGGACAGTGG + Intergenic
925949790 2:8899546-8899568 ATGATCCAACAACAGGACTGAGG - Intronic
926217310 2:10913498-10913520 ATGGCCCACCAGAAGGACTGGGG - Exonic
926864512 2:17343000-17343022 ATGATCCAGCAGCAGGACTAAGG + Intergenic
926999637 2:18780433-18780455 ATGATCTAACAGAAGGTATGTGG - Intergenic
927196064 2:20547629-20547651 ATGCTCCCACAGAAACAATGAGG + Intergenic
928476497 2:31632486-31632508 ATGATTCAGCAGCAGGACTGAGG + Intergenic
928617510 2:33054823-33054845 ATGATCCAACAACAGGACTGAGG - Intronic
928677088 2:33660900-33660922 CTGATCCAGCAGCAGGACTGAGG + Intergenic
929330488 2:40675313-40675335 ATGATCTAACAACAGGACTGAGG + Intergenic
930038643 2:47103753-47103775 ATGATCCAACAACAGGACTGAGG + Intronic
930631594 2:53759834-53759856 ATGATACAGCAGCAGGACTGAGG + Intronic
931540596 2:63325403-63325425 ATGATCCAACAATAGGACTGAGG + Intronic
931663305 2:64590189-64590211 ATAAGAAAACAGAAGGAATGAGG - Intronic
932533189 2:72560523-72560545 ATGCCCCAAAAGAAGAAATGAGG - Intronic
932568851 2:72926450-72926472 ATGGTACAACAAAAAGAATGAGG + Intronic
932917718 2:75875808-75875830 ATGATCCAGCAGCAGGACTGAGG + Intergenic
933175209 2:79166398-79166420 ATGATCCAACAGCAGGACTGAGG - Intergenic
933342261 2:81038414-81038436 ATGATCCAACAACAGGACTGAGG + Intergenic
934867243 2:97824254-97824276 ATAATCCAACAGCAGGACTGAGG + Intronic
935112728 2:100106857-100106879 ATGATCCCAGAAAAGGAAAGAGG + Intronic
935748732 2:106212094-106212116 ATGATCCAGCAGCAGGACTGAGG + Intergenic
936387259 2:112041377-112041399 ATGATCCAGCAGCAGGACTGAGG - Intergenic
936802182 2:116283130-116283152 GTGATCCAACAACAGGACTGAGG + Intergenic
938806074 2:134808246-134808268 ATGATCCAACAACAGGACTGAGG - Intergenic
939287173 2:140147001-140147023 CTGATGCAAGAGAAAGAATGGGG - Intergenic
939493606 2:142903693-142903715 ATGATCCAGCAGCAGGACTGAGG - Intronic
939953577 2:148505077-148505099 AGGATGGAAAAGAAGGAATGTGG + Intronic
941243521 2:163069915-163069937 ATGATCCAACAACAGGACTGAGG + Intergenic
941271702 2:163438169-163438191 ATGATTTAACAGAAAGAAAGAGG + Intergenic
941537448 2:166741002-166741024 ATGATCCAACAACAGGACTGAGG - Intergenic
941995458 2:171597575-171597597 ATGATCCAAAAGAAAAAATAGGG - Intergenic
942580382 2:177410812-177410834 ATGATCCAGCAGCAGGACTGAGG - Intronic
942816543 2:180059781-180059803 ATGACCCAGCAGCAGGACTGAGG + Intergenic
942830840 2:180236419-180236441 ATGATCCAGCAGCAGGACTGAGG + Intergenic
942938378 2:181586331-181586353 ATGCTCCAACACAAGGCATCAGG + Intronic
943102965 2:183509808-183509830 ATGATCCAACAATAGGACTGAGG - Intergenic
944039296 2:195336217-195336239 ATGATCCAGCAGCAGGACTGAGG - Intergenic
944729108 2:202500072-202500094 ATGATCCAACAACAGGACTGAGG + Intronic
944950636 2:204744928-204744950 CAGATGCAACAGAAGGACTGAGG + Intronic
946207258 2:218118777-218118799 ATGATCCAACAACAGGACTGAGG - Intergenic
946465033 2:219904352-219904374 AAGATCCAAGAGAGGGAAGGAGG - Intergenic
948092824 2:235309022-235309044 ATAATCCAACAAAAGGAAATGGG - Intergenic
948155987 2:235781886-235781908 TTGATTCTACAAAAGGAATGCGG - Intronic
1168741354 20:193941-193963 ATGATCCAGCAGAAGGACTGAGG - Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170805347 20:19625136-19625158 AGGATGCAATAGAAGTAATGGGG - Intronic
1171261604 20:23739082-23739104 ATGATCCAACAACAAGACTGAGG + Intergenic
1171270743 20:23814972-23814994 ATGATCCAACAACAAGACTGAGG + Intergenic
1172340756 20:34155587-34155609 ATGATCCAGCAACAGGACTGAGG + Intergenic
1173663851 20:44751929-44751951 CTGCTCCAAGAGAGGGAATGAGG + Exonic
1177135176 21:17299939-17299961 ATGATCCAACAACAGGACTGAGG + Intergenic
1177263462 21:18756427-18756449 ATGATTCAGCAGCAGGACTGAGG - Intergenic
1177500846 21:21952625-21952647 ATGCTTCAACTGAAGAAATGGGG - Intergenic
1177896308 21:26858817-26858839 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1178905933 21:36636334-36636356 AGGATCCAACAAAAGGAAGTTGG - Intergenic
1179166889 21:38942271-38942293 ATGATGGAAAAGCAGGAATGTGG + Intergenic
1179259084 21:39742515-39742537 ATGATCCAGCAGCAGGGCTGAGG - Intergenic
1180943302 22:19674557-19674579 ATGATCCAACAGAAAGAACAAGG - Intergenic
1181126482 22:20704915-20704937 ATAATCAAACAGAAGGAAAGGGG - Intergenic
1182304870 22:29360978-29361000 ATGATGCACCAGGAAGAATGGGG + Intronic
1182500193 22:30741134-30741156 AGGATGTAAGAGAAGGAATGGGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
949448872 3:4164393-4164415 ATGATCCAACAACAGAACTGAGG - Intronic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
951020595 3:17777604-17777626 ATGATCCAACAACAGGACTGAGG + Intronic
951200637 3:19872663-19872685 ATGATCCAGCAGCAGGACTGAGG - Intergenic
951239576 3:20272841-20272863 ATGATCCAACAACAAGACTGAGG + Intergenic
951746825 3:25987606-25987628 ATGATCCAGCAGATTTAATGGGG - Intergenic
951837918 3:27003044-27003066 ATGATCCAGCAGCAGGACTGAGG + Intergenic
952453135 3:33449803-33449825 ATGATCCAACAATAGGACTGAGG + Intergenic
952922175 3:38293099-38293121 ATGATCCAGCAGCAGGACTGAGG - Intronic
953041884 3:39262912-39262934 ATGGTTCAACAGTTGGAATGAGG + Intergenic
953648669 3:44779304-44779326 ATGCTCCAATAAAAGGAATTAGG - Intronic
953724945 3:45389461-45389483 ATGATGCACAAGAAGGAAGGCGG + Intronic
954096384 3:48331949-48331971 ATGATCCAGCAGCAGGACTGAGG - Intergenic
954232162 3:49225925-49225947 ATGATCCAACAACAGGACTGAGG - Intronic
954587084 3:51745488-51745510 ATGATCCAACAACAGGACTGAGG + Intergenic
954599028 3:51853321-51853343 ATGATCCAATAACAGGACTGAGG + Intergenic
954657159 3:52201878-52201900 ATGATCCAACTCAAGGATTCCGG + Intronic
956842853 3:73156340-73156362 ATGATCCAACAACAGGACTGAGG - Intergenic
957000232 3:74876072-74876094 ATGATCCAGCAGCAGGACTGAGG - Intergenic
957038160 3:75313994-75314016 GTGATCCAATAGAAAGAATGTGG - Intergenic
957136666 3:76297042-76297064 GTGAGCCATCAGAATGAATGGGG + Intronic
957848968 3:85780342-85780364 TTGATTCAACAGAAAGATTGAGG - Intronic
958016207 3:87942473-87942495 ATGATCCAGCAGCAGGACTGAGG - Intergenic
958601484 3:96300944-96300966 ATGATCCAACAACAGGACTGAGG + Intergenic
958629754 3:96670517-96670539 ATGATCCAGCAGCAGGACTGAGG - Intergenic
959803986 3:110529012-110529034 ATAATGCAGCAGAGGGAATGGGG + Intergenic
960063789 3:113349679-113349701 ATGATCCAACAACAGTACTGAGG + Intronic
960277528 3:115744809-115744831 ATGATCCAGCAACAGGACTGAGG + Intergenic
961086157 3:124069260-124069282 GTGATCCAATAGAAAGAATGTGG - Intergenic
961261776 3:125607525-125607547 ATGATCCAACAACAGGACTGAGG + Intergenic
961439231 3:126942703-126942725 ATCCTCCAACAGAAGGAATGTGG - Intronic
962153506 3:132918444-132918466 ATCGTCCAACAGAATGGATGAGG + Intergenic
962495494 3:135935644-135935666 ATGATCCAGCAGCAGGACTGAGG + Intergenic
963021355 3:140875499-140875521 ATGATCCAACAACAGGACTGAGG + Intergenic
963188001 3:142440025-142440047 ATGATCCAGCAGCAGGACTGAGG + Intronic
963409112 3:144906702-144906724 ATGATCCATCAACAGGACTGAGG - Intergenic
963696850 3:148573993-148574015 ATGATCCAACAACAGGACTGAGG + Intergenic
963727424 3:148937842-148937864 AGGGTCCACCAGAAGGCATGCGG + Intergenic
963915817 3:150858086-150858108 ATGATCCAGCAGCAGGACTGAGG + Intergenic
963945054 3:151136557-151136579 ATTCTCCAATAGAAGGAATGGGG + Intronic
963992190 3:151667777-151667799 ATGATCCAACAACAGGATTGAGG - Intergenic
964064604 3:152562987-152563009 ATGATCCAATAACAGGACTGAGG + Intergenic
964815157 3:160709730-160709752 AAAATCCAACAGTAGGAAAGTGG + Intergenic
964953475 3:162325110-162325132 ATGATCCAGCAGCAGGACTGAGG + Intergenic
965054747 3:163698165-163698187 ATGATCCAGCAGCAGGACTGAGG - Intergenic
965062851 3:163804747-163804769 ATGATCCAACAACAGGACTGAGG + Intergenic
965139299 3:164814650-164814672 ATGATCCAACAACAGGACTGAGG + Intergenic
965825209 3:172722952-172722974 ACGATCCAGCAGCAGGACTGAGG + Intergenic
966353554 3:179056582-179056604 ATGATCCAGCAGCAGGACTGAGG + Intronic
966403833 3:179574635-179574657 ATGATACACCAGAAGGTATGAGG + Intronic
966697889 3:182811531-182811553 ATGAGCCAAAGGAAGGAAGGTGG - Intronic
967623612 3:191662338-191662360 ATGATCCAGCAGCAGGACTGAGG + Intergenic
967703044 3:192617303-192617325 AGGATCCCTCAGAAGGAAAGTGG + Intronic
968391124 4:193793-193815 ATGATCCAGCAGCAGGACTGAGG - Intergenic
971281101 4:25243217-25243239 ATGATCCAACAACAGGACTGAGG - Intronic
971578573 4:28306177-28306199 ATGATCCAACAACAGGACTGAGG + Intergenic
972133193 4:35861988-35862010 ATGATCCAACAATAGGACTGAGG - Intergenic
972240545 4:37187341-37187363 ATCAGCCAACAGAAGGATGGAGG - Intergenic
972244557 4:37231160-37231182 AAGATAAAACAAAAGGAATGTGG - Intergenic
972701195 4:41495575-41495597 ATGATGACACGGAAGGAATGTGG + Intronic
974174598 4:58307519-58307541 ATGATCCAACAACAAGACTGAGG + Intergenic
974187412 4:58461261-58461283 ATGATCCAACAACAGGATTGAGG + Intergenic
974480857 4:62441288-62441310 TGGATCCTCCAGAAGGAATGGGG - Intergenic
974520518 4:62975755-62975777 ATGATCCAGCAGCAGGACTGAGG + Intergenic
974537231 4:63187800-63187822 ATGATCCAACAACAGGATTGAGG + Intergenic
975048098 4:69828031-69828053 ATGATCCAACAACAGGACTGAGG + Intronic
975063341 4:70032684-70032706 ATGATGCATAAAAAGGAATGAGG + Intronic
975378117 4:73668641-73668663 TTGATCCACAAAAAGGAATGCGG - Intergenic
976108122 4:81641242-81641264 ATGATTTAGCAGAAAGAATGGGG - Intronic
976174211 4:82335873-82335895 ATGATCCAACAACAGGACTGAGG - Intergenic
976189893 4:82477764-82477786 ATGATCCAGCAGCAGGACTGAGG + Intergenic
976480217 4:85534443-85534465 CTGCTCCAGCAGAAGGAATGTGG + Intronic
976637266 4:87299294-87299316 AAGAGCCATCAGAAGGAAAGAGG + Intergenic
977617960 4:99106337-99106359 ATGATCCAGCAGCAGGACTGAGG - Intergenic
977834831 4:101635112-101635134 ATGATCCAACAACAGGACTGAGG - Intronic
977884182 4:102238468-102238490 ATGATCCAACAACAGGACTGAGG + Intergenic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978330147 4:107603565-107603587 GTGATCCAACAGAAGAGGTGAGG - Intronic
978586751 4:110282443-110282465 ATGATCCAGCAGCAGGACTGAGG - Intergenic
978909609 4:114048561-114048583 ATGATCCAGCAGCAGGACTGAGG + Intergenic
980290803 4:130846049-130846071 ATGATCCAACAACAGGACTGAGG - Intergenic
981173453 4:141652011-141652033 GTAATCCCACAGAAGGGATGAGG + Intronic
981252639 4:142622666-142622688 GTGATCCAAGAGAAGGAACTTGG + Intronic
982877389 4:160665519-160665541 ATGATCCAACAACAGGACTGAGG + Intergenic
983084363 4:163425927-163425949 ATGATCCAACAACAGGACTGAGG + Intergenic
983160785 4:164411655-164411677 ATGTTCCAAGAGAATGAAAGTGG + Intergenic
983666973 4:170193454-170193476 ATGATCCAGCAGTAGGACTGAGG - Intergenic
983834843 4:172374003-172374025 ACGATCCAACAACAGGAATGAGG - Intronic
984634858 4:182099844-182099866 ATGAGCAAACAGAAGTTATGAGG + Intergenic
984723798 4:183001141-183001163 ATGATCCAGCAGCAGGACTGAGG + Intergenic
984917548 4:184737604-184737626 ATGATCCAACAACAGGACTAAGG + Intergenic
984939703 4:184920240-184920262 ATGATCCAACAACAGGACTGAGG - Intergenic
985259940 4:188106006-188106028 CACATGCAACAGAAGGAATGGGG + Intronic
986066047 5:4235286-4235308 ATTATATATCAGAAGGAATGTGG + Intergenic
986933406 5:12854633-12854655 ATGATCCAACAACAGGACTAAGG + Intergenic
986988802 5:13527943-13527965 TTGATCCCACAGAAAGAATCTGG + Intergenic
987503470 5:18742990-18743012 ATGGTCCAACAACAGGACTGAGG - Intergenic
987545147 5:19304165-19304187 ATGATCCAACAACAGGACTGAGG - Intergenic
988357890 5:30200775-30200797 ATGATCCAACAACATGACTGAGG + Intergenic
988457040 5:31395644-31395666 ATGATACAGCAGCAGGACTGAGG - Intergenic
988591918 5:32556693-32556715 CTGATCCAACAACAGGACTGAGG - Intronic
988957129 5:36331106-36331128 ATGATCCAGCAGCAGGACTGAGG - Intergenic
989964275 5:50450424-50450446 ATGATCCAACAACAGGACTGAGG - Intergenic
990116827 5:52400466-52400488 ATGATCCAACAACAGGACTGAGG + Intergenic
990187532 5:53224053-53224075 ATGATCCAGCAACAGGACTGAGG - Intergenic
990367770 5:55088006-55088028 ATGATCCAACAACAGGACTGAGG - Intergenic
990892342 5:60662766-60662788 ATGATCCAGGAGCAGGATTGAGG + Intronic
990946418 5:61254286-61254308 ATGAGCTAAGGGAAGGAATGAGG + Intergenic
992049459 5:72929478-72929500 ATGATCCAGCAACAGGATTGAGG + Intergenic
992455289 5:76910667-76910689 ATGATCCAGCAACAGGACTGAGG + Intronic
992545858 5:77813182-77813204 ATGATCCAACAACAAGACTGAGG + Intronic
993202351 5:84831605-84831627 AGGATCCATCAAAGGGAATGAGG + Intergenic
993492747 5:88571748-88571770 AGGATCCAAGCTAAGGAATGTGG - Intergenic
994231642 5:97315106-97315128 ATGATCCAACAACAGGACTGAGG - Intergenic
994924918 5:106102561-106102583 TTGATCTCACAGAAGAAATGGGG + Intergenic
995465699 5:112447796-112447818 ATGATCCAGCAGCAGGACTGAGG + Intergenic
995583327 5:113622635-113622657 ATGATCCAACAACAGGACTGAGG - Intergenic
995706523 5:114993554-114993576 ATGATCCAACAACAGGACTGAGG + Intergenic
996099137 5:119429687-119429709 ATGATCCAACAACAGAATTGAGG - Intergenic
996328320 5:122301735-122301757 ATGTTCCAAAAGAAGGAAACTGG - Intergenic
997072491 5:130636768-130636790 ATGATTCAACAACAGGACTGAGG + Intergenic
997631063 5:135369310-135369332 ATGAGCCCACAGGGGGAATGAGG + Intronic
998094643 5:139390387-139390409 CTCAACCACCAGAAGGAATGAGG + Intergenic
998111550 5:139506489-139506511 ATGATCCAACAACAGGACTGAGG + Intergenic
998915164 5:147004321-147004343 ATGATGCAACAATAGGACTGAGG + Intronic
999945670 5:156592606-156592628 ATTATTCCACAGAAGGAAAGGGG - Intronic
1000082509 5:157861293-157861315 AAGATCCCAGAGATGGAATGTGG + Intergenic
1000085325 5:157883191-157883213 ATGATCCAACAACAGGATTGAGG + Intergenic
1002397952 5:178972552-178972574 ATGATCCAAGAGTAGAAGTGAGG + Intergenic
1003285070 6:4727155-4727177 ATCTGCCAACACAAGGAATGGGG + Intronic
1003453446 6:6259235-6259257 AGTCTCCAAGAGAAGGAATGTGG + Intronic
1003805872 6:9725469-9725491 ATGATCCAACAATAGGACTGAGG + Intronic
1004236868 6:13882133-13882155 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1004531457 6:16458852-16458874 ATGATCCAACAACAGGACTGAGG + Intronic
1004812328 6:19274387-19274409 ATGATCCAACAACAGGACTGAGG + Intergenic
1005213540 6:23497713-23497735 ATGACCCAACAGAAAACATGAGG + Intergenic
1005323613 6:24678960-24678982 ATGATCCAGCAGCAGGACTGAGG - Intronic
1005601320 6:27429200-27429222 ATGAACCTACAGAAGTAATAGGG + Intergenic
1006221872 6:32498196-32498218 ATGATCCAACAACAGGACTGAGG + Intergenic
1006756865 6:36423676-36423698 ATGATACCACTGAAGAAATGAGG - Intronic
1008195845 6:48519369-48519391 ATAATCCAACAGTAGAGATGGGG + Intergenic
1008890007 6:56477060-56477082 ATTATTCAACAGAAACAATGTGG + Intronic
1009385855 6:63083628-63083650 ATGATCCAACAACAGAACTGAGG - Intergenic
1009407626 6:63330062-63330084 ATGATCCAACAACAGGACTGAGG - Intergenic
1009470892 6:64027795-64027817 ATGATCCAACAACAGGATTGAGG + Intronic
1009544832 6:65008717-65008739 ATGATCCACCAGCAGGACTGAGG + Intronic
1009872865 6:69471296-69471318 ATGATCCAACAACAGGATTGAGG + Intergenic
1009991461 6:70847573-70847595 ATGAGCAAACAGAAGAAATTAGG - Intronic
1010075036 6:71788726-71788748 ATGATCCAACAACAGGACTGAGG + Intergenic
1010269909 6:73906964-73906986 ATGATCCAACAACAGGACTGAGG + Intergenic
1010893551 6:81341119-81341141 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1011076824 6:83447140-83447162 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1011189729 6:84716489-84716511 ATGATCCAGCAGCAAGACTGAGG - Intronic
1011374962 6:86678217-86678239 ATGATCCAACAACAGGACTGAGG - Intergenic
1011539806 6:88417408-88417430 ATGATCCTGCAGCAGGACTGAGG - Intergenic
1012441466 6:99265641-99265663 ATGATCCAACAACAGGACTGAGG - Intergenic
1012645266 6:101671489-101671511 ATGTTACAACAGATTGAATGAGG - Intronic
1013543596 6:111134812-111134834 ATGATCCAGCAGCAGGACTGAGG + Intronic
1013888768 6:115001143-115001165 ATGGTCCAACAACAGGACTGAGG + Intergenic
1013907765 6:115237978-115238000 ATGATCCAACAACAGGACTGAGG - Intergenic
1013977507 6:116094251-116094273 ATGATCCAATAACAGGACTGAGG + Intergenic
1014416965 6:121195242-121195264 ATGATCCAGCAGATCCAATGAGG + Intronic
1015188251 6:130443778-130443800 ATGATCCAAATAAAGGAATTGGG + Intergenic
1015826365 6:137316849-137316871 ATGTTGCAAGAGAAGCAATGTGG - Intergenic
1015865431 6:137722181-137722203 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1017587035 6:155937809-155937831 AAGAGCCAAAAGAAGGAGTGGGG + Intergenic
1018687573 6:166315905-166315927 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1018691358 6:166346577-166346599 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1018761093 6:166895016-166895038 ATGATCCAGCAGCAGGACTGAGG + Intronic
1021356501 7:19657867-19657889 ATGATCCAACAACAGGACTGAGG - Intergenic
1021756643 7:23858930-23858952 ATGATCCAACAACAGGACTGAGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023077876 7:36501590-36501612 ATGATCCAACAATAGGACTGAGG - Intergenic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1023439250 7:40169480-40169502 ATGATCCAGCAGCAGGACTGAGG - Intronic
1024870701 7:53959540-53959562 ATGATCCAAAAACAGGACTGAGG - Intergenic
1025798382 7:64760837-64760859 ATGATCCAACAACAGGACTGAGG - Intergenic
1028290431 7:89058577-89058599 TTGATGCAAAATAAGGAATGGGG + Intronic
1028495145 7:91453159-91453181 ATGATCCAACAACAGGACTGAGG - Intergenic
1028588531 7:92473880-92473902 ATGATCCAGCAGCAGGACTGAGG - Intronic
1028889097 7:95966976-95966998 ATGATCCAACTGAAACATTGGGG + Intronic
1030337343 7:108341214-108341236 ATGATCCGGCAGCAGGACTGAGG + Intronic
1030420594 7:109302368-109302390 ATGATCCAACAACAGGACTGAGG + Intergenic
1030711545 7:112756052-112756074 GGGATCCAAGAGAAGGAATTTGG + Intergenic
1030843440 7:114382330-114382352 ATGATCCAGCAGCAGGACTGAGG - Intronic
1031264608 7:119567577-119567599 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1031676026 7:124613369-124613391 ATTAACCAACAAAAGGAAAGAGG + Intergenic
1031731865 7:125310994-125311016 ATGATCCAACAATAGAACTGAGG + Intergenic
1031743726 7:125468170-125468192 CTGGTCCCGCAGAAGGAATGGGG - Intergenic
1032426042 7:131822850-131822872 ATGATCCAGCAGCAGGATTGAGG - Intergenic
1033759161 7:144421752-144421774 ATGATCCAACAACAGGACTGAGG - Intergenic
1034249239 7:149675171-149675193 AAGATCCAGCAGCAGGACTGAGG + Intergenic
1034875203 7:154719480-154719502 ATGATCCCACAGGAGAAATCTGG + Intronic
1036078977 8:5532228-5532250 GTGAACAAACAGAAGAAATGAGG - Intergenic
1036126608 8:6068666-6068688 GTGATGAAAAAGAAGGAATGAGG - Intergenic
1037057368 8:14458771-14458793 ATGATACCCCAGAAGCAATGAGG + Intronic
1037571047 8:20158062-20158084 ATGATCCAGCAGCAGGACTGAGG + Intronic
1037712008 8:21362335-21362357 ATGTTCCAAGAGAAGGAAGAGGG - Intergenic
1038430700 8:27497220-27497242 ATGATCCAACAACAGGACTGAGG - Intronic
1039693096 8:39882322-39882344 ATGATCCAACAACAGGACTGAGG - Intergenic
1040527697 8:48239162-48239184 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1040527781 8:48239722-48239744 ATGATCCAACAACAAGACTGAGG + Intergenic
1040649037 8:49429499-49429521 ATGATCCAACAACAGGACTGAGG + Intergenic
1040667789 8:49653833-49653855 ATGATCCAACAACAGGATTGAGG - Intergenic
1040796736 8:51296103-51296125 ATGATCCAACAACAGGACTGAGG - Intergenic
1040953481 8:52957824-52957846 ATGATCCAACAACAGGACTGAGG + Intergenic
1040964978 8:53073921-53073943 ATGATCCAACAACAGGACTGAGG - Intergenic
1040971380 8:53140406-53140428 ATGATCCAACAACAGGACTGAGG - Intergenic
1041001989 8:53462757-53462779 ATGATCCAACAACAGGACTGAGG + Intergenic
1041663814 8:60423525-60423547 ATGATCGAGCAGCAGGACTGAGG - Intergenic
1042056168 8:64766774-64766796 ATGATCCAGCAGCAGGACTGAGG + Intronic
1042771993 8:72391120-72391142 ATGATCCAACAACATGACTGAGG + Intergenic
1043257135 8:78150747-78150769 ATGATCCAAAAACAGGACTGAGG + Intergenic
1043490020 8:80739917-80739939 ATGATCCAGCAGCAGGACTGAGG + Intronic
1044005356 8:86931342-86931364 ATGATCCAACAACAGGACTGAGG - Intronic
1044489393 8:92794087-92794109 ATGATCCTTTAGAGGGAATGTGG + Intergenic
1044815094 8:96103677-96103699 AAGAGCAAACAGAATGAATGAGG + Intergenic
1045716490 8:105053012-105053034 ATTTTCCCACAGAAGCAATGAGG + Intronic
1045858629 8:106791731-106791753 ATGATCCAACAACAGGACTGAGG + Intergenic
1046216167 8:111150598-111150620 ATGATCAAAAAGAACAAATGAGG - Intergenic
1046788109 8:118290003-118290025 ATGATCAAACAGAAGGGTTTGGG + Intronic
1047443825 8:124902175-124902197 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1048126563 8:131641993-131642015 ATGATCCAACAAGAGGAAAGTGG + Intergenic
1048544493 8:135373983-135374005 GTGAGACATCAGAAGGAATGTGG - Intergenic
1048818028 8:138352307-138352329 ATGATCAAACTGAAGTAATTGGG - Intronic
1048843075 8:138581881-138581903 TTGATCCCACAGAAGGAATCAGG - Intergenic
1049881047 8:145063583-145063605 TTGATCCACAAAAAGGAATGCGG + Intergenic
1050883432 9:10734098-10734120 GTGATACAACAGAAGAAATCAGG + Intergenic
1051374401 9:16388952-16388974 GAGATCCAACAGATGGAAAGAGG - Intergenic
1051935350 9:22437715-22437737 ATGATCCAACAACAGGATTGAGG + Intergenic
1052184149 9:25569994-25570016 ATGATCAAACATAAGGTAAGTGG - Intergenic
1052189979 9:25648935-25648957 AAGATCCTACAAGAGGAATGGGG - Intergenic
1052289576 9:26826528-26826550 ATGATCCAACAACAGGACTGAGG + Intergenic
1052528942 9:29656837-29656859 ATGACCCAGCAGCAGGACTGAGG - Intergenic
1052538468 9:29777268-29777290 ATGACCCAGCAGCAGGACTGAGG - Intergenic
1055458208 9:76492586-76492608 ATAATCCAACAAAAGGACTGAGG - Intronic
1056160915 9:83892496-83892518 ATGATCCAAAAGAGGGAAAAAGG + Intronic
1056392704 9:86154106-86154128 ATGATCCAACAATAGGACTGAGG - Intergenic
1056704652 9:88941581-88941603 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1059139311 9:111836910-111836932 ATTATCCATCAGAGGGAATTTGG - Intergenic
1060830112 9:126708400-126708422 ATGGGCCAAGAGAAGGAGTGTGG - Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1186254198 X:7701615-7701637 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1188097600 X:26043284-26043306 ATGATCCAACAACAGGACTGAGG + Intergenic
1188136596 X:26500641-26500663 ATGATCCAACAACAGGACTGAGG + Intergenic
1188523704 X:31066519-31066541 AGGATCCAACAGAAGGCCTCAGG - Intergenic
1189946587 X:46186844-46186866 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1190541543 X:51482791-51482813 ATGATCCAACAACAGGACTGAGG + Intergenic
1191167041 X:57402153-57402175 ATGATCCAGCAGCAGGACTGAGG - Intronic
1192482681 X:71499038-71499060 ATGATCCAGCAAAAGGACTGAGG - Intronic
1192869936 X:75175590-75175612 ATGATCCAACAACAGGACTGAGG - Intergenic
1192939922 X:75901521-75901543 GTGATCCAGCAGCAGGACTGAGG - Intergenic
1193171926 X:78346982-78347004 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1193306759 X:79959850-79959872 ATGATGCAGCAGCAGGACTGAGG + Intergenic
1194801219 X:98275740-98275762 GTCATCCAAAATAAGGAATGTGG + Intergenic
1195439646 X:104885925-104885947 ATGATCCAACAACAGGACCGAGG + Intronic
1195535003 X:106000861-106000883 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1195552305 X:106183844-106183866 ATGATCCAACAACAGGACTGAGG - Intronic
1195850950 X:109280838-109280860 ATGATCCAACAACAGGACTGAGG - Intergenic
1196127279 X:112113624-112113646 ATGATTCAACAATAGGACTGAGG - Intergenic
1196419302 X:115506461-115506483 ATGATCCAACAACAGGACTGAGG - Intergenic
1196489061 X:116246667-116246689 ATGATCCAACAACAGGACTGAGG + Intergenic
1196527292 X:116741142-116741164 ATGATCCAGCAGCAGGACTGAGG - Intergenic
1197106649 X:122724626-122724648 ATGATCAGAAAGAAGGAATTGGG - Intergenic
1197269646 X:124411660-124411682 ATGACCCAACAGAAGAGAGGTGG - Intronic
1197513483 X:127398184-127398206 ATGATCCAACAACAGGACTGAGG + Intergenic
1199811313 X:151352644-151352666 ATGAACCAAAGGAAGGAAGGAGG - Intergenic
1199832334 X:151559046-151559068 ATGATCCAACAACAGGACTGAGG - Intergenic
1200800950 Y:7386720-7386742 ATGATCCAACAACAGGACTGAGG - Intergenic
1200833972 Y:7714625-7714647 ATGAGGAAACAGCAGGAATGTGG + Intergenic
1200945394 Y:8830500-8830522 ATGATCCAACAACAGGACTGAGG + Intergenic
1200966850 Y:9046588-9046610 ATGAACCAACAACAGGACTGAGG + Intergenic
1201236252 Y:11914725-11914747 TAGAGCCACCAGAAGGAATGGGG + Intergenic
1201271870 Y:12263538-12263560 ATGATCCAACAACAGGACTGAGG - Intergenic
1201311980 Y:12605548-12605570 ATGATCCAACAACAAGACTGAGG - Intergenic
1201403830 Y:13630973-13630995 ATGATCCAACAACAGGACTGAGG + Intergenic
1201407442 Y:13663182-13663204 ATGATCCAACAGCAGGACTGAGG - Intergenic
1201429768 Y:13892121-13892143 ATGATCCAACAACAGGACTGCGG + Intergenic
1201455186 Y:14161406-14161428 ATGATCCAACGACAGGAATGAGG + Intergenic
1201487652 Y:14509489-14509511 ATGATCCAACAACAGGACTGAGG + Intergenic
1201496324 Y:14594223-14594245 ATGATCCAACAGAAGGAATGAGG - Intronic
1201515900 Y:14818556-14818578 GTGATCCAACAGCAGGACTGAGG - Intronic
1201555806 Y:15263883-15263905 ATGATCCAACAACAGGACTGAGG + Intergenic
1201568518 Y:15390657-15390679 ATGATCCAACAACAGGACTGAGG - Intergenic
1201631327 Y:16074427-16074449 ATGATCCAACAACAGGATTTAGG + Intergenic
1201678543 Y:16616328-16616350 AAGAACCAACATAAGGAATGTGG + Intergenic
1201724055 Y:17134686-17134708 ATGATCCAGCAGCAGGATGGAGG - Intergenic
1201729525 Y:17189466-17189488 ATGATCCAACAACAGGAATGAGG - Intergenic
1201743926 Y:17350773-17350795 ATGATCCAACAACAGTAATGAGG - Intergenic
1201905631 Y:19083503-19083525 ATGATCCAGCAGCAGGACTGAGG + Intergenic
1201911156 Y:19134715-19134737 ATGATCCAACAACAGGAATGAGG + Intergenic
1202074638 Y:21025939-21025961 ATGGTCCAACAACAGGAGTGAGG - Intergenic
1202089802 Y:21177854-21177876 ATGATCCAACAACAGGACTGAGG - Intergenic
1202146610 Y:21805587-21805609 ATGAACCAACAACAGGACTGAGG - Intergenic
1202242954 Y:22789322-22789344 ATAATCCAACAACAGGAATGAGG + Intergenic
1202257955 Y:22940482-22940504 AGGATCCAACAACAGGACTGAGG + Intergenic
1202271983 Y:23081755-23081777 ATAATCCAACAACAGGACTGAGG - Intergenic
1202294043 Y:23338927-23338949 ATAATCCAACAACAGGACTGAGG + Intergenic
1202395941 Y:24423072-24423094 ATAATCCAACAACAGGAATGAGG + Intergenic
1202410945 Y:24574240-24574262 AGGATCCAACAACAGGACTGAGG + Intergenic
1202424980 Y:24715499-24715521 ATAATCCAACAACAGGACTGAGG - Intergenic
1202445809 Y:24954586-24954608 ATAATCCAACAACAGGACTGAGG + Intergenic
1202459836 Y:25095832-25095854 AGGATCCAACAACAGGACTGAGG - Intergenic
1202474844 Y:25247020-25247042 ATAATCCAACAACAGGAATGAGG - Intergenic