ID: 1201496425

View in Genome Browser
Species Human (GRCh38)
Location Y:14594886-14594908
Sequence GTGGGGATCCGTACTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 117, 2: 64, 3: 44, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201496416_1201496425 0 Left 1201496416 Y:14594863-14594885 CCATGATCTGAGTCAAGGTCCCA 0: 64
1: 79
2: 72
3: 82
4: 301
Right 1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG 0: 1
1: 117
2: 64
3: 44
4: 152
1201496414_1201496425 2 Left 1201496414 Y:14594861-14594883 CCCCATGATCTGAGTCAAGGTCC 0: 65
1: 76
2: 71
3: 49
4: 113
Right 1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG 0: 1
1: 117
2: 64
3: 44
4: 152
1201496412_1201496425 7 Left 1201496412 Y:14594856-14594878 CCAGTCCCCATGATCTGAGTCAA 0: 62
1: 82
2: 77
3: 57
4: 123
Right 1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG 0: 1
1: 117
2: 64
3: 44
4: 152
1201496415_1201496425 1 Left 1201496415 Y:14594862-14594884 CCCATGATCTGAGTCAAGGTCCC 0: 67
1: 73
2: 71
3: 48
4: 123
Right 1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG 0: 1
1: 117
2: 64
3: 44
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201496425 Original CRISPR GTGGGGATCCGTACTGGGGA TGG Intronic
900637651 1:3673877-3673899 GTGGGAACACGGACTGGGGAGGG + Intronic
902295307 1:15463028-15463050 GTGGGGATGTGACCTGGGGAGGG + Intronic
902298153 1:15482560-15482582 GTGGGGATGTGACCTGGGGAGGG + Intronic
903682325 1:25105228-25105250 ATGAGAATCTGTACTGGGGAGGG - Intergenic
904688211 1:32275424-32275446 GTGGGGACCCGTCGTGGGGGTGG + Intronic
906766686 1:48440509-48440531 GTGGGGATTCATACTGGGGATGG - Intronic
907842349 1:58170159-58170181 GTGGGGATCCATACTGGGGATGG - Intronic
909359413 1:74743687-74743709 GTGGGGAGCCATACTGGGGATGG + Intronic
910397440 1:86806638-86806660 GTGGGGATCCATAGTGGGGATGG + Intergenic
911845613 1:102747581-102747603 GTGGGGATCCCTAGTGGGGATGG + Intergenic
912021304 1:105111540-105111562 GTGGGGATCCATACTGGGGATGG - Intergenic
913382629 1:118228056-118228078 GTGGGGATCCATACTGGGCACGG - Intergenic
913469525 1:119174819-119174841 GTGGGGATCCATACTGGGGATGG - Intergenic
913713511 1:121511075-121511097 GTGAGGATCCATACTGGGGATGG - Intergenic
915260571 1:154674010-154674032 GTGGGGATCCATACTGGGGATGG - Intergenic
916083679 1:161252935-161252957 GTAGGGATCCATACTGGGGATGG - Intergenic
916114439 1:161475087-161475109 GTGGGGATCCATACTGGGGATGG - Intergenic
916939534 1:169664531-169664553 GTGGGGATCCATACTGGGGATGG - Intronic
917086135 1:171307373-171307395 GTGGGGATCCATACTGGGGATGG - Intergenic
917227582 1:172800914-172800936 GTGGGGATCCATACTGTGGACGG - Intergenic
917279884 1:173370371-173370393 GTGGGGATCCATACTGGGGATGG - Intergenic
917281162 1:173379232-173379254 GTGGGGATCCATACTGGGGACGG - Intergenic
917445790 1:175104995-175105017 GTGGGGATCCATACTGGGGATGG + Intronic
918750169 1:188261208-188261230 GTGGGGTTCCATATTGGGGATGG + Intergenic
919558658 1:199092779-199092801 GTGGGGATCCATACTGGGGATGG - Intergenic
921019703 1:211224708-211224730 GTGGGGATCCATACTGGGGATGG - Intergenic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
923631109 1:235649940-235649962 GTGGGGGCCCAGACTGGGGAAGG + Exonic
1062777787 10:168820-168842 GTGGGGATCAGTGCTGGAGTAGG + Intronic
1063117858 10:3084849-3084871 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117882 10:3084923-3084945 ATGGGGGACCGTGCTGGGGAGGG - Intronic
1063117892 10:3084947-3084969 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117902 10:3084971-3084993 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117912 10:3084995-3085017 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117922 10:3085019-3085041 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117932 10:3085043-3085065 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117942 10:3085067-3085089 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117952 10:3085091-3085113 GTGGCGGACCGTGCTGGGGAGGG - Intronic
1063117965 10:3085140-3085162 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063117985 10:3085213-3085235 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063117996 10:3085237-3085259 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063118007 10:3085261-3085283 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063118077 10:3085482-3085504 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063118092 10:3085531-3085553 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063118101 10:3085555-3085577 GTGGGGGACTGTGCTGGGGAGGG - Intronic
1063118112 10:3085579-3085601 GTGGGGGACTGTGCTGGGGAAGG - Intronic
1063118122 10:3085603-3085625 GTGGGGGACTGTGCTGGGGAAGG - Intronic
1063118132 10:3085627-3085649 GTGGGGGACTGTGCTGGGGAAGG - Intronic
1063118142 10:3085651-3085673 GTGGGGGACTGTGCTGGGGAAGG - Intronic
1063118152 10:3085675-3085697 GTGGGGGACTGTGCTGGGGAAGG - Intronic
1063321693 10:5057716-5057738 GTGGGGATCCATACTGGGGATGG + Intronic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1064603560 10:17016324-17016346 GTGGGGATCCATACTGGGGAAGG + Intronic
1066614565 10:37282110-37282132 GTGGGGATCCATACTGGGGATGG + Intronic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1068240661 10:54297991-54298013 GTGGGGATCCATACTGGGCACGG - Intronic
1068404939 10:56575702-56575724 GTGGGGATCCATATTGGGGATGG + Intergenic
1068500323 10:57835200-57835222 GTGGGGATCCATACTGGGGATGG - Intergenic
1068863638 10:61871791-61871813 CTGGGGATCTGCTCTGGGGACGG - Intergenic
1069137328 10:64782299-64782321 GTGGGGATCCATATTGAGGACGG + Intergenic
1069365077 10:67687917-67687939 GTGGGGATCCATACTGGGGATGG + Intronic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1071834870 10:89408885-89408907 GTGGGGATCCATAATGGGGATGG - Intronic
1072052110 10:91714978-91715000 TTGGGGATCCATGCAGGGGATGG + Intergenic
1072371647 10:94770856-94770878 GTGGGGATCCATACTGGGGATGG + Intronic
1073251603 10:102123255-102123277 GTGTGGATCAGACCTGGGGAGGG + Intergenic
1073970767 10:109043790-109043812 GTGGGGATCCATACTGGAGATGG - Intergenic
1074613056 10:115039567-115039589 GTGGGGATCCACACTAGGGATGG - Intergenic
1074742638 10:116499924-116499946 GTGGGGATCCATACTGGGGATGG + Intergenic
1076228427 10:128799778-128799800 GTGGTGGTCAGAACTGGGGAGGG + Intergenic
1076542640 10:131223922-131223944 GTGGGGATGTGGCCTGGGGAGGG - Intronic
1076623206 10:131806226-131806248 GTGGGGACAGGTGCTGGGGAGGG - Intergenic
1076645532 10:131951891-131951913 GTGAGGACCCCAACTGGGGATGG + Intronic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1079731204 11:23939069-23939091 GTGGGGATCCATACTGGGGATGG + Intergenic
1079811646 11:25004793-25004815 GTGGGGATCCATACTGGGGATGG + Intronic
1081033446 11:38114002-38114024 GTGGGGATCCATAATGGGGACGG - Intergenic
1081146013 11:39563189-39563211 GTGGGGATCCATACTGGGGATGG - Intergenic
1081421440 11:42877483-42877505 GTGGGGATCCATACTGGGGATGG - Intergenic
1083749536 11:64753726-64753748 GTGGGGCTGGGGACTGGGGATGG - Intronic
1084142867 11:67245226-67245248 GTGAGGCTTCGTAATGGGGATGG - Exonic
1084211026 11:67622542-67622564 GTTGGGATCCATACTGGGGATGG - Intergenic
1086317405 11:85609005-85609027 GTGGGGATCCATACTGGGGATGG - Intronic
1087075015 11:94120692-94120714 GTGGGGATCCATACTGGGGATGG - Intergenic
1087683312 11:101238153-101238175 GTGGGGATCCATACTGAGGATGG + Intergenic
1088492560 11:110401893-110401915 GTGGGGATCCATACTGGGGATGG - Intergenic
1091573896 12:1714662-1714684 GTGGGGATCCACACTGAGAATGG + Intronic
1091924117 12:4329966-4329988 ATGGGGAATGGTACTGGGGAGGG + Intronic
1092472324 12:8790780-8790802 GTGGGGATCCATACTGGGGATGG - Intergenic
1093345267 12:18033793-18033815 GTGGGGATCCATACTGGGGATGG - Intergenic
1093580560 12:20780779-20780801 GTGGGGATCCATACTGGGGATGG + Intergenic
1094319948 12:29172907-29172929 GTGGGGCTCCATACTGGGGATGG + Intronic
1094338085 12:29383247-29383269 GTGGGGATCCATACTGGGGATGG + Intergenic
1096799823 12:54102806-54102828 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1097684814 12:62681362-62681384 GTGAGGAGCCGAACTGGGGAAGG - Intronic
1099376269 12:81898943-81898965 GTGGGGATCCATACTGGGGACGG - Intergenic
1099414722 12:82371949-82371971 CAGTGGATCCATACTGGGGACGG + Intronic
1100209815 12:92389109-92389131 GTGGGGATCCACACTGGGGATGG - Intergenic
1100530213 12:95455492-95455514 GTGGGGATCCATACTATGGATGG + Intergenic
1101779684 12:107824227-107824249 GTGGGGATCCACGCTGGAGATGG - Intergenic
1103396497 12:120611225-120611247 GTGGGGTTCAGTACAGGAGAAGG + Intergenic
1103452644 12:121040108-121040130 CTGGGGATCCGGGCTGGGCATGG + Intergenic
1104306203 12:127612766-127612788 GTGGGGATCCATACTGGGGATGG - Intergenic
1104789273 12:131471756-131471778 GTGGGGTTCGCTCCTGGGGATGG - Intergenic
1105762507 13:23527343-23527365 GTGGGGATCCATACTGGGGATGG - Intergenic
1106162715 13:27215226-27215248 GTGGGAATACATACGGGGGACGG - Intergenic
1107732370 13:43361147-43361169 GTGGGGATCCGTTCTACAGAAGG - Intronic
1108848620 13:54702751-54702773 GTGGGGATCCATACTGGGGATGG - Intergenic
1109232308 13:59773241-59773263 GTGGGGATCCTTACTGCCGAAGG - Intronic
1109424440 13:62152399-62152421 GTTGGGATCCACACTGGGGATGG - Intergenic
1109501050 13:63236388-63236410 GTGGGGATCCATACTGCTGATGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112519142 13:100080785-100080807 GTAGGGATCCATACTGGGGATGG - Intergenic
1112538395 13:100283302-100283324 GTGGGGATCCATACTGGGGATGG - Intronic
1115774748 14:36702920-36702942 GTGGGGATATGTAGCGGGGAGGG - Intronic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1120198812 14:81515503-81515525 GTGGGGATCCATACTGGGGACGG - Intronic
1121690869 14:95876488-95876510 GTCGGGGTCCCTACAGGGGAGGG - Intergenic
1125464104 15:39934107-39934129 GCGGGGCTCCGCGCTGGGGACGG - Intergenic
1125543502 15:40486518-40486540 GTGGGGCTCAGTGATGGGGAGGG - Intergenic
1126072054 15:44873908-44873930 GTGGGGATCAATACTGGTGATGG + Intergenic
1126173718 15:45716086-45716108 GTGGGCATCAGTCCTGTGGATGG + Intergenic
1128154877 15:65385917-65385939 GCGGGGACCAGTCCTGGGGATGG + Exonic
1129175213 15:73835235-73835257 GTGTGGTACCCTACTGGGGAAGG + Intergenic
1131411225 15:92209806-92209828 GTGGGGATCCATACTGGGGATGG - Intergenic
1133202268 16:4211274-4211296 ATGGGGATCCTTAGTGGGGTGGG - Intronic
1135339654 16:21634952-21634974 GTGGGGATCTGTACTGGGGACGG + Intronic
1136551782 16:30985875-30985897 GTGGGGATCCCAGCTTGGGAAGG - Intronic
1138354755 16:56368239-56368261 GTGGGGATGTGAGCTGGGGAAGG - Intronic
1139661393 16:68423411-68423433 GTGGGGATCCATGATGGGGCTGG + Intronic
1142810119 17:2392085-2392107 GGCGGGATCTGTTCTGGGGAGGG - Intronic
1143527277 17:7479766-7479788 GCGGGGGTCAGTCCTGGGGAAGG - Intronic
1143862074 17:9898360-9898382 GTGGGTATCTGGACTGGGGTGGG - Intronic
1145303706 17:21657555-21657577 GTGGGGATCTGCACTTGGGGTGG - Intergenic
1145346338 17:22044294-22044316 GTGGGGATCTGCACTTGGGGTGG + Intergenic
1146310527 17:31764979-31765001 GTGGGGATCCATACTGGGGTTGG - Intergenic
1149073915 17:52575677-52575699 GTCGGGATCCATACTGGGGATGG - Intergenic
1149209681 17:54288734-54288756 GCAGGGATCCATACTGGGGATGG - Intergenic
1151568028 17:74910854-74910876 GTGGGGATCCATACTGGGGATGG - Intergenic
1151718815 17:75844520-75844542 GTAGGGATCCCAGCTGGGGAAGG - Exonic
1152731990 17:81977147-81977169 GGGAGGATCCGTACAGGGGCGGG + Intronic
1155476106 18:26237122-26237144 GTGGGGATCCGTACTAGGGATGG + Intronic
1157857547 18:51116341-51116363 GTGGGGATCCATACTGGGGTTGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1161079412 19:2303136-2303158 GTGGGGGTCCGGGCTGGGGAGGG - Intronic
1161242076 19:3228298-3228320 GTGGGGGTCCTTCCTGGGGGAGG - Intronic
1161598221 19:5163426-5163448 GTGGGGATCCATACTGGGGATGG + Intronic
1162107928 19:8381969-8381991 GTGGGGATCCATACTGGGGATGG - Intronic
1162237459 19:9320473-9320495 GTGGGGATCCATACTGGGGATGG + Intergenic
1162851034 19:13431190-13431212 GTGGGGAACAGTCCTGGGGGTGG + Intronic
1164578556 19:29420025-29420047 GTGTGGCTCTTTACTGGGGAAGG - Intergenic
1165847096 19:38825222-38825244 GTGGGGATCCATACTGGGGATGG - Intronic
1166140976 19:40805013-40805035 GTTGGGAGGCGTCCTGGGGAGGG + Intronic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
925949889 2:8900205-8900227 GTGGAGATCCATACTGGGGATGG + Intronic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
929330381 2:40674654-40674676 GTGGGGATCCATACTGGGGATGG - Intergenic
929550227 2:42885807-42885829 GTGGGGTTCCGAACAGGAGAAGG + Intergenic
929554126 2:42914208-42914230 GTGGGCATCCAGACTGTGGAGGG - Intergenic
930038539 2:47103095-47103117 GTGGGGATCCATACTGGGGATGG - Intronic
931691224 2:64836514-64836536 GTAGGGATCCCTGGTGGGGAGGG + Intergenic
932062392 2:68519569-68519591 ATGGGGAATCGTAGTGGGGAGGG - Intronic
932459198 2:71871591-71871613 GGGGGGAGATGTACTGGGGAGGG + Intergenic
933342160 2:81037756-81037778 GTGGGTTTCCATACTGGGGATGG - Intergenic
934867132 2:97823598-97823620 GTGGGCATCCATACTGGGGATGG - Intronic
938397416 2:130961804-130961826 GTGGGGAGAAGTGCTGGGGAAGG - Intronic
938656904 2:133443608-133443630 GTGGTGATCCATGCTGGAGACGG - Intronic
941243421 2:163069256-163069278 GTGGGGATCCATACTGGAGATGG - Intergenic
941537549 2:166741661-166741683 GTGGGGATCCATACTTGGGATGG + Intergenic
943103066 2:183510462-183510484 GTGGGGATCCACACTGGGGATGG + Intergenic
943133753 2:183887938-183887960 GTGGGGATCCATACTGGGGATGG - Intergenic
944729009 2:202499413-202499435 GTGGGGATCCATAATGGGGATGG - Intronic
946191872 2:218011722-218011744 GTGGGGAGCTGCAATGGGGACGG - Intergenic
946207354 2:218119436-218119458 GTGGGCATCCATACTGGGGATGG + Intergenic
947839178 2:233196805-233196827 GTGGGGATGAGTTGTGGGGAAGG - Intronic
1171261506 20:23738426-23738448 GTGGGGATCCATACTGGGGATGG - Intergenic
1171270651 20:23814317-23814339 GTGGGGAGCCCTACTGGGGATGG - Intergenic
1171521228 20:25775240-25775262 GTGGGGATCTGCACTTGGGGTGG - Exonic
1171796616 20:29571541-29571563 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1171851625 20:30312625-30312647 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1174107325 20:48171982-48172004 GTGGGGGTCAGGACTGGGCAGGG - Intergenic
1175766693 20:61597463-61597485 TGGGGAATCTGTACTGGGGAAGG - Intronic
1175931951 20:62497647-62497669 GGGTGGGTCCGTATTGGGGATGG + Intergenic
1177135071 21:17299287-17299309 GTGGGGATCCATACTGGCTATGG - Intergenic
1178687046 21:34720178-34720200 GTGGTGGTGGGTACTGGGGATGG - Intergenic
1179831871 21:44001900-44001922 GTGGGGTTCGGGACTGGGGCAGG - Intergenic
1180786303 22:18549678-18549700 GAGGGGATGGGTACTGGGGAGGG - Intergenic
1181391256 22:22583287-22583309 GTGGGTGTCAGGACTGGGGAGGG - Intergenic
1182668091 22:31973522-31973544 GTTGGGATAGGTACTGGGGAAGG + Intergenic
1183678054 22:39310798-39310820 GTGGGGATGCTGACTGGGCAGGG - Intergenic
1185323720 22:50215559-50215581 GTGTGGATCCGTGCTGGCGGTGG + Intronic
950104466 3:10379415-10379437 GTGGGGATACGGGTTGGGGAGGG + Intronic
951020493 3:17776968-17776990 GTGGGGATCCATATTGGGGATGG - Intronic
951630167 3:24711224-24711246 GTGGGGATCAGTACTGACAATGG - Intergenic
952453031 3:33449144-33449166 GTGGGGATCCATAGTGGGGATGG - Intergenic
952940944 3:38443952-38443974 GTGGGGATCCATACTGGGGATGG + Intergenic
952959937 3:38582942-38582964 GTGGGCATCCTTCCTGGGAATGG - Intronic
953622937 3:44548420-44548442 GTAGGGATCCATACTGGGGAAGG + Intergenic
954586982 3:51744829-51744851 GTGGGGATCCATACTGGGGATGG - Intergenic
956842958 3:73157001-73157023 GTGGGGATCCATACTGGGGATGG + Intergenic
957637044 3:82799925-82799947 GTGGGGAACCATCCTGGAGATGG - Intergenic
957799886 3:85063947-85063969 GTGTGGAAACCTACTGGGGAGGG - Intronic
958549213 3:95592980-95593002 GTGGAGATCCATACTGGGGATGG + Intergenic
958575811 3:95949075-95949097 GTGGGGATCCATACTGGGGATGG + Intergenic
958601388 3:96300286-96300308 GTGGGGATCCATACTGGGGATGG - Intergenic
960063692 3:113349026-113349048 GTGGTGATCCATACTGGTGACGG - Intronic
961043283 3:123692474-123692496 GTGGGGATCAGGACTGGGAGGGG + Intronic
961261664 3:125606866-125606888 GTGGGGATTCATACTGGGGACGG - Intergenic
962753724 3:138452648-138452670 GTCGGGATTCCTGCTGGGGAGGG - Intronic
963021254 3:140874849-140874871 GTAGGGATCCACACTGGGGATGG - Intergenic
963409219 3:144907361-144907383 GTGGGGATACATACTGGGGACGG + Intergenic
963992291 3:151668470-151668492 GTGGGGATCTGTACTGGAGATGG + Intergenic
964064501 3:152562321-152562343 GTGGGGATCCATACTGGGGATGG - Intergenic
964972236 3:162577026-162577048 GTAGGGATCCATACTGGGGGTGG - Intergenic
965062748 3:163804089-163804111 GTGGGGATCCATACTGGTGATGG - Intergenic
966201318 3:177361737-177361759 ATAGGGATCCGTGCTAGGGAAGG + Intergenic
967911819 3:194548748-194548770 GTGTGCATCGGCACTGGGGAGGG + Intergenic
968612668 4:1564206-1564228 GTGGGGATCTGAGCAGGGGAGGG + Intergenic
969791956 4:9498630-9498652 GTGCGGAGCCCTACTGGGGCGGG + Intergenic
971281206 4:25243870-25243892 GTGGGGATCCATACTGGGGATGG + Intronic
971578467 4:28305518-28305540 GTGGGGAACCATACGGGGGATGG - Intergenic
972133307 4:35862688-35862710 GTGGGGATCCATACTGGGGATGG + Intergenic
973045858 4:45533958-45533980 GTGGGGATCCATACTGGAGATGG - Intergenic
974174497 4:58306863-58306885 GTGGGGATCCATACTAGGGATGG - Intergenic
974187311 4:58460602-58460624 GTGGGGATCCATACTGGGGATGG - Intergenic
974537133 4:63187141-63187163 ATGGGGATCCATACTGGGGATGG - Intergenic
974838859 4:67279795-67279817 GTGAGGATCCATACTGGGGATGG + Intergenic
975595840 4:76047659-76047681 GTGGGGATCCATACTGGGGATGG + Intronic
975599001 4:76079696-76079718 GTGGGAAGCCATAATGGGGAGGG + Intronic
976174322 4:82336534-82336556 GTGGGGATCCATACTGGGGATGG + Intergenic
977834928 4:101635764-101635786 GTGGGGATCCATACTAGGGATGG + Intronic
977884091 4:102237809-102237831 GTGGGGATCCATACTGGGGATGG - Intergenic
978621040 4:110634256-110634278 GTGGGGATCCAGGGTGGGGACGG + Intronic
978721913 4:111920080-111920102 GTGGGCATCTGTGCTAGGGAGGG + Intergenic
978741726 4:112145355-112145377 GGGCGGAGCCGTACAGGGGAGGG - Intergenic
980290901 4:130846706-130846728 GTGGGGATCCATACTGGGGACGG + Intergenic
982701121 4:158660491-158660513 ATGGGGATCCATACTGGGGATGG - Intergenic
982877290 4:160664861-160664883 GTGGGAATCCATACTGAGGATGG - Intergenic
983834936 4:172374662-172374684 GTGGGGATCCATACTGGGGATGG + Intronic
984917444 4:184736945-184736967 GTGGGGATCCATACTGGGGATGG - Intergenic
985316018 4:188659498-188659520 GCGGGGGTGCGCACTGGGGAGGG - Intergenic
985422259 4:189795965-189795987 GTGGGGGTCCCTGCTGGGAAGGG - Intergenic
986681684 5:10239074-10239096 GTGGACATCGGTAGTGGGGACGG - Exonic
986933303 5:12853975-12853997 GTGGGGATCCATACTGGGGATGG - Intergenic
987545246 5:19304811-19304833 GTGGGAATCCATACTGGAGAAGG + Intergenic
987929885 5:24389669-24389691 GTGGAGATCCATACTGGGGATGG - Intergenic
988341984 5:29984655-29984677 GTGTGGATATATACTGGGGAGGG - Intergenic
988357795 5:30200115-30200137 GTGGGGATCCATACTGGGGATGG - Intergenic
988592021 5:32557352-32557374 GTGGGGACCCATACTGCGGATGG + Intronic
988605505 5:32675473-32675495 GTGGGGACCCATACTGGCGATGG + Intergenic
989496236 5:42113825-42113847 GTGGGGATCCATACTGGGGATGG - Intergenic
989957340 5:50372850-50372872 GGGGGGCTCCATACTGGGGATGG - Intergenic
989964373 5:50451076-50451098 GTGGGGATCCATACTGGGGATGG + Intergenic
990367877 5:55088666-55088688 GTGGGGATCCATACTGGGGATGG + Intergenic
991471161 5:66970303-66970325 GTGGGTAGCAGTAATGGGGAAGG + Intronic
992455191 5:76910009-76910031 GTGGGGATCCATACTGGGGATGG - Intronic
994231742 5:97315755-97315777 TTGGGGATCCATACTGGGGACGG + Intergenic
995706428 5:114992897-114992919 GTGGGAATCCATACTGGGAACGG - Intergenic
996097545 5:119414660-119414682 GTGGGGTGCGGAACTGGGGAAGG + Intergenic
996099240 5:119430334-119430356 TTGGGGATCCATACTGGGGACGG + Intergenic
997072391 5:130636108-130636130 GTGGGGATCCATACTGGGGATGG - Intergenic
998915052 5:147003658-147003680 GTGGGGATCCATACTGGGGATGG - Intronic
999140485 5:149358173-149358195 GTGGGGTTCCCAGCTGGGGAGGG + Intronic
1000085219 5:157882532-157882554 GTGGGGATCCATACTGGGGATGG - Intergenic
1001910162 5:175510003-175510025 GAGAGGAGACGTACTGGGGAAGG - Intronic
1003805777 6:9724810-9724832 GTGGGGATCCATACTGGGGATGG - Intronic
1004033763 6:11901136-11901158 GTGGGGACCGGTGCTGGGGCAGG - Intergenic
1004531349 6:16458196-16458218 GTGGGGATCCATAATGGGGATGG - Intronic
1004812227 6:19273729-19273751 GTGGGGATCCATATTGGGGATGG - Intergenic
1006296330 6:33171675-33171697 TTGGGGAGGGGTACTGGGGAGGG - Intronic
1006610909 6:35293830-35293852 GTCGGCATCAGGACTGGGGATGG - Exonic
1007030021 6:38618926-38618948 GTGGGGATCCATACTGGGGACGG - Intronic
1008186906 6:48404385-48404407 GTGGGGAAGCGTACTAGGGTAGG - Intergenic
1008587005 6:52959533-52959555 GTGGGGATCCATACTGGGGATGG + Intergenic
1009385953 6:63084284-63084306 GTGGGGATTCATACTGCAGATGG + Intergenic
1009407716 6:63330713-63330735 GTGAGGATCCATACTGGGGATGG + Intergenic
1009470790 6:64027137-64027159 GTGGGGATCCATACTGGGGATGG - Intronic
1009872766 6:69470650-69470672 GTGGGGATCCATACCGGGGATGG - Intergenic
1010269809 6:73906306-73906328 GCGGGGATCCATACTGGGGATGG - Intergenic
1011375060 6:86678873-86678895 GTGGGGATCCATACTGGGGATGG + Intergenic
1013907862 6:115238634-115238656 GTGGGGATCCATACTGGGGATGG + Intergenic
1013977407 6:116093604-116093626 GTGGGGATCCATACTGGGGATGG - Intergenic
1015915801 6:138215295-138215317 GTGGGCATCCTATCTGGGGAGGG + Intronic
1016184014 6:141178676-141178698 GTGGGGATCCATACTGGGGATGG - Intergenic
1019473936 7:1235256-1235278 CTGGGGAGCCGTACTTGGGTGGG - Intronic
1021356595 7:19658529-19658551 GTGGAGATCCATACTGGGAACGG + Intergenic
1021901930 7:25293999-25294021 GTAGGTATCTGTACTGGGGTAGG + Intergenic
1023077975 7:36502249-36502271 GTGGGGATCCATACTGGGGATGG + Intergenic
1024870811 7:53960198-53960220 GTGGGGATCCATACGGGGGATGG + Intergenic
1027791098 7:82639593-82639615 GTGGGGATCCATACTGGGGTCGG - Intergenic
1028495245 7:91453812-91453834 GTGGGGATCCATACTGGGGATGG + Intergenic
1029540422 7:101179462-101179484 GCGGGGATCCGTGGAGGGGAAGG + Intronic
1030420496 7:109301710-109301732 GTGGGGATCCATACTGGGGATGG - Intergenic
1030947718 7:115746083-115746105 GTAGGGAACCATCCTGGGGATGG - Intergenic
1031731763 7:125310336-125310358 GTGGGGATCCATACTGGGGATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033759267 7:144422409-144422431 GTGGGGATCCATACTGGGGATGG + Intergenic
1034579998 7:152033768-152033790 GTGGGGATCCATACTGGGGATGG + Intronic
1037833104 8:22200770-22200792 GAGGGGAACAGTACTTGGGAAGG - Intronic
1038224974 8:25647195-25647217 GTGTGGATCTGTAGAGGGGAGGG - Intergenic
1038430805 8:27497879-27497901 GTGGAGATCCATACTGGGGACGG + Intronic
1038596606 8:28891277-28891299 GTGGAGATTCGTCCAGGGGAGGG - Intronic
1038638770 8:29307493-29307515 GTGGGGATCCATACTGGGGATGG - Intergenic
1038912023 8:31975364-31975386 GTGAGGATGGGAACTGGGGAAGG + Intronic
1039275984 8:35934521-35934543 CTGGGTATCCATACTGGGGATGG - Intergenic
1039460034 8:37736412-37736434 TTGGGTATCCGTCCTGGGGCTGG - Exonic
1039693194 8:39882981-39883003 GTGGGGATCCATAATGGGGATGG + Intergenic
1040648933 8:49428840-49428862 GTGGGGATCCATACTGGGGACGG - Intergenic
1040965081 8:53074580-53074602 GTGGGGATCCATACTGGGGATGG + Intergenic
1040971483 8:53141065-53141087 GTGGGGATCCATACTGGGGAAGG + Intergenic
1040999961 8:53440347-53440369 GTGGGGATCCATACTGGGGATGG + Intergenic
1041001884 8:53462096-53462118 GTGGGGATCCATACTGGGGATGG - Intergenic
1041848499 8:62359454-62359476 CTGAGGATCAGTACTTGGGAGGG + Intronic
1042771886 8:72390466-72390488 GTGGGGATCCGTACCAGGGACGG - Intergenic
1042919589 8:73908528-73908550 GTGGGGATTCATACTGGGGACGG - Intergenic
1043257031 8:78150090-78150112 GTGGGGATCCATAATGGGGATGG - Intergenic
1043284884 8:78516287-78516309 GTGGTGATCCGTCCCGGGGCGGG + Exonic
1044456652 8:92398377-92398399 GTGGGGATCCATACTGGAGATGG + Intergenic
1045858529 8:106791072-106791094 GTGGGGATCCATACTGGGGATGG - Intergenic
1048976332 8:139674916-139674938 GAGGGGATCCAGAGTGGGGAAGG - Intronic
1049337737 8:142095562-142095584 CTGAGGAACCTTACTGGGGAGGG + Intergenic
1049418307 8:142505511-142505533 GTGGGGATCCACACTGGGTTGGG + Intronic
1050327117 9:4508501-4508523 CTGGGGATGCCTCCTGGGGATGG - Intronic
1051935252 9:22437055-22437077 GTGGGGATCCATACTGGGGACGG - Intergenic
1052057795 9:23923358-23923380 GGGGGGATTCATACTGGGGACGG + Intergenic
1053789403 9:41675880-41675902 GAGGGGAATGGTACTGGGGAAGG + Intergenic
1054155740 9:61638882-61638904 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054177741 9:61887566-61887588 GAGGGGAACGGTACTGGGGAAGG + Intergenic
1054475508 9:65569883-65569905 GAGGGGAATGGTACTGGGGAAGG - Intergenic
1054659790 9:67693259-67693281 GAGGGGAACGGTACTGGGGAAGG - Intergenic
1056392810 9:86154763-86154785 GTGGGGATCCATACTGGGGATGG + Intergenic
1062542571 9:137048179-137048201 GTCTGGGTCTGTACTGGGGAGGG - Exonic
1185527167 X:789111-789133 GTGGGGATGAGTCCTGGTGAGGG - Intergenic
1185618187 X:1435990-1436012 CTGGGGAGGCGCACTGGGGAGGG - Intronic
1185620276 X:1449828-1449850 GTGGGGATAGTTACTGGTGATGG - Intronic
1190541435 X:51482133-51482155 GTGGGGATCCATACTGGGGACGG - Intergenic
1191205961 X:57834499-57834521 GTGGGGATCCATACTGGGGATGG + Intergenic
1192482788 X:71499680-71499702 GTGGGGATCCATACTGGGGACGG + Intronic
1192580465 X:72277098-72277120 TTCGGGATTCCTACTGGGGATGG - Intronic
1195439543 X:104885265-104885287 GTGGGGATCCATACTGGGGATGG - Intronic
1196127378 X:112114283-112114305 GTGGGGATCCATACTGGGGACGG + Intergenic
1196419413 X:115507112-115507134 GTGGGGCTCCATACTGGGGATGG + Intergenic
1196661969 X:118279407-118279429 GTGGGGATCCATACTGGGGATGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197513379 X:127397525-127397547 GTGGGGATCCATACTGGGGATGG - Intergenic
1198562604 X:137867104-137867126 GTGGGAATCCTTACTTGGTAGGG - Intergenic
1198780708 X:140232699-140232721 GTTGGGAAGGGTACTGGGGAGGG - Intergenic
1199832432 X:151559701-151559723 GTGCGGATCCATACTGGGGATGG + Intergenic
1200037698 X:153344146-153344168 CTGGGGCTCCATCCTGGGGAGGG - Intronic
1200776197 Y:7172301-7172323 GTGGGGATCCATACTGGGGATGG - Intergenic
1200801050 Y:7387358-7387380 GTGGGGATCCATACTGGGGATGG + Intergenic
1200959286 Y:8982380-8982402 GTGGGGATCCATACTGGGGATGG - Intergenic
1201312078 Y:12606206-12606228 GTGGGGATCCATACTGGGGATGG + Intergenic
1201403741 Y:13630322-13630344 GTGGGGATCCATACTGGGCTTGG - Intergenic
1201407536 Y:13663839-13663861 GTGGGGATCCATACTGGGGTTGG + Intergenic
1201429669 Y:13891463-13891485 GTGGGGATCCATACTGGGGATGG - Intergenic
1201455089 Y:14160747-14160769 GTGGGGATCCATATGGGGGAAGG - Intergenic
1201468812 Y:14312749-14312771 GTGGGGATCCATGCTGGGGATGG - Intergenic
1201487554 Y:14508833-14508855 GTGGGGATCCATACTGGGGATGG - Intergenic
1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG + Intronic
1201530526 Y:14985972-14985994 GTGGGGATTTATACTGGGGATGG - Intergenic
1201555710 Y:15263236-15263258 GTGGGGATCCATACTGGGGATGG - Intergenic
1201568604 Y:15391313-15391335 GTGGGGATCTATACTGGAGATGG + Intergenic
1201604693 Y:15771965-15771987 GTGGGGAACCATATTGGGGATGG - Intergenic
1201631231 Y:16073769-16073791 GTGGGGATTCATACTGGGGATGG - Intergenic
1201744017 Y:17351432-17351454 GTAGGGATGCATACTGGGGATGG + Intergenic
1202074727 Y:21026597-21026619 GTGGGGATCCATACTGGGGATGG + Intergenic
1202146712 Y:21806376-21806398 GTGGGGATCCATACAAGGGATGG + Intergenic
1202192637 Y:22260390-22260412 AGGGGAATCCATACTGGGGATGG + Intergenic
1202242857 Y:22788663-22788685 GTGGGGATCCATACTGGGGATGG - Intergenic
1202272084 Y:23082415-23082437 GTGGGGATCCATACTGGGGATGG + Intergenic
1202293942 Y:23338267-23338289 GTGGGGATCCATACTGGGGATGG - Intergenic
1202395844 Y:24422413-24422435 GTGGGGATCCATACTGGGGATGG - Intergenic
1202425081 Y:24716159-24716181 GTGGGGATCCATACTGGGGATGG + Intergenic
1202445708 Y:24953926-24953948 GTGGGGATCCATACTGGGGATGG - Intergenic
1202474941 Y:25247679-25247701 GTGGGGATCCATACTGGGGATGG + Intergenic