ID: 1201499934

View in Genome Browser
Species Human (GRCh38)
Location Y:14630762-14630784
Sequence TGTCTTCCTCAAGAATGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201499930_1201499934 22 Left 1201499930 Y:14630717-14630739 CCAATAATTTCTAGTTGAAAACA No data
Right 1201499934 Y:14630762-14630784 TGTCTTCCTCAAGAATGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201499934 Original CRISPR TGTCTTCCTCAAGAATGTCG AGG Intronic