ID: 1201499934

View in Genome Browser
Species Human (GRCh38)
Location Y:14630762-14630784
Sequence TGTCTTCCTCAAGAATGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201499930_1201499934 22 Left 1201499930 Y:14630717-14630739 CCAATAATTTCTAGTTGAAAACA 0: 1
1: 1
2: 0
3: 30
4: 418
Right 1201499934 Y:14630762-14630784 TGTCTTCCTCAAGAATGTCGAGG 0: 1
1: 0
2: 0
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201499934 Original CRISPR TGTCTTCCTCAAGAATGTCG AGG Intronic
901896721 1:12319871-12319893 TTTCTTCCTCAAGAAGTTCAAGG + Intronic
902824312 1:18962545-18962567 TGCCTTCCTCAAAAAGGGCGTGG + Intergenic
904679215 1:32217065-32217087 TGTCTTTCTCCAGACTGTCCAGG + Intronic
909104584 1:71392536-71392558 TGGGTTCCTCATGAATGGCGTGG + Intergenic
909340854 1:74529406-74529428 TGTCATCCTCAAAAATGTCACGG + Intronic
910873291 1:91854278-91854300 TGCCTTCCTCAAAAATGCCTGGG + Intronic
912651800 1:111446446-111446468 TTTATCCCTCAAGAATGTCAAGG + Intronic
917405839 1:174707918-174707940 TGTCTTCTGAAAGAATGTGGAGG - Intronic
917825642 1:178817570-178817592 TTTCTTCTTCAAGATTGTCTTGG + Intronic
918382297 1:183968392-183968414 TGTCTTTCTCAAAAATCTCCAGG + Intronic
921607081 1:217168352-217168374 TGTCCTCTTCAAAAATGTCAAGG - Intergenic
922231871 1:223694474-223694496 TGTGTTCTTCAAAAATGTCAAGG + Intergenic
1064739222 10:18415093-18415115 TTTCTTCCTCAAGAAGCTCATGG + Intronic
1065382673 10:25105361-25105383 TATCCTCCTGAAGAATGTCCTGG + Intergenic
1067116135 10:43436914-43436936 TGTCTTCCTGAAGAAGGCTGGGG + Intronic
1068170932 10:53393648-53393670 TGTCGTCTTCAAGAATGTCATGG - Intergenic
1070980637 10:80643638-80643660 TGTTTGCCTCAAGCAGGTCGGGG - Intronic
1071251665 10:83825383-83825405 TGTCTCACTCAAGAATGCCCTGG + Intergenic
1071463223 10:85918102-85918124 TGTCTTCCACATGAGTGTCAAGG - Intronic
1071906579 10:90180900-90180922 TTTCTTAGTCAAGAATGTTGAGG + Intergenic
1072707802 10:97694386-97694408 TGTATTCCTCAAAAATGTCAAGG + Intergenic
1073835769 10:107439630-107439652 GGTCTTCCTGAAGATTGTCTTGG + Intergenic
1074416231 10:113269307-113269329 TGTCCTCCTCCAGACTGTCTAGG - Intergenic
1075053040 10:119197195-119197217 TCTGTTCCTCAAAAATGTCAAGG - Intergenic
1079663408 11:23071616-23071638 AGTCTTCCTCAAAACTGTCAAGG + Intergenic
1080694581 11:34590608-34590630 TTTCTTCTTCAAGAAGGTCTTGG + Intergenic
1081047196 11:38290832-38290854 TGTGTTCCTCAAAAATGTTACGG - Intergenic
1081327799 11:41767312-41767334 ATTCTTCCTCAAGAATGCCTTGG - Intergenic
1082860023 11:57846660-57846682 TTTCTTTTTCAAGAATGTTGTGG - Intergenic
1085144393 11:74180289-74180311 TGTATTCCTCAAAACTGTTGAGG + Intronic
1088619970 11:111671784-111671806 TGTCTTCATCAAGAAGGATGTGG - Intronic
1091855024 12:3732501-3732523 TGACATCCTAAAGAATGTCCTGG - Intronic
1091861571 12:3790034-3790056 TGGATTCCTCAAGAATGGCTTGG - Intergenic
1093330438 12:17830839-17830861 TGTCTTTCTAAAGAATTTGGTGG - Intergenic
1098200958 12:68055179-68055201 TGTCTTTCTCAAGAAGCTCTAGG + Intergenic
1099535835 12:83843187-83843209 TGTCTTCCTCAAAAAAGTCATGG + Intergenic
1100050338 12:90441475-90441497 TCTCTTCAGCAAGAATGTCTGGG + Intergenic
1100056422 12:90516623-90516645 TGCCTTTCTCCAGAATGTCCAGG - Intergenic
1101312265 12:103592576-103592598 TGTGTACATCAAGAATGTCCAGG - Intronic
1104289172 12:127453192-127453214 TGGCTTCCTGAAGATTGTCTAGG - Intergenic
1104487363 12:129163087-129163109 TGTCTTGCCCAAGAATTTCAGGG - Intronic
1106045440 13:26135775-26135797 TGGATCCCTCAAGAATGTCTTGG + Intronic
1106837696 13:33653215-33653237 CGTCTTCCTCAAGAGTGTTTTGG - Intergenic
1108779551 13:53812641-53812663 TATCTTAATAAAGAATGTCGTGG + Intergenic
1112193056 13:97196660-97196682 TGTCTTCCTCCTGAGTGTCCGGG + Intergenic
1113007160 13:105719895-105719917 TGTCTTCCACAAGAATAAAGAGG + Intergenic
1113366555 13:109681978-109682000 TGTCTTCCTCATAGATGTCCGGG + Intergenic
1116478741 14:45371976-45371998 TGTCTTCCACAGCAATGTCATGG + Intergenic
1116555601 14:46301278-46301300 TGTCTTCCTCACAAATGTTATGG - Intergenic
1119445134 14:74657105-74657127 TGTCTTCTTCATGAATGTTTGGG + Intronic
1119841583 14:77797444-77797466 TTTCTTCTTCAAGAATGTTTTGG + Intergenic
1123483961 15:20667284-20667306 TGTATTCTTCAAAAATGTCAAGG + Intergenic
1125504073 15:40256956-40256978 TGTCATCTACAAAAATGTCGAGG + Intronic
1127993751 15:64139840-64139862 TGTATTCTTCAAAAATGTCATGG - Exonic
1128151808 15:65367857-65367879 TGTGTGCCTGAAGGATGTCGAGG - Intronic
1129597993 15:76979851-76979873 TGTCCTCCTCAAGAAGGATGTGG - Intergenic
1130486386 15:84400646-84400668 AGCCTTCATCAAGAATGCCGAGG - Intergenic
1131653252 15:94425358-94425380 TTTCTTCTTCAAGAATGTCTTGG + Intronic
1133558070 16:6924462-6924484 TGGCTTCCTCAAGAATGGCTTGG - Intronic
1136383913 16:29911079-29911101 ACTCTTCCTCAAGGATGTCCTGG - Exonic
1137536921 16:49334279-49334301 TGTGTTGCTCAACAATGTCAGGG + Intergenic
1137646733 16:50081477-50081499 AGTCTTCCTTAAGATTGTAGTGG + Intronic
1138566654 16:57838364-57838386 TGTCATCCTCAAAAATTGCGTGG - Intronic
1140980034 16:80099358-80099380 TCTCTTCTTCAAGATTGTCTTGG + Intergenic
1141065441 16:80910101-80910123 TGTCTTCCTCTGGACTGTAGAGG - Intergenic
1144252860 17:13437298-13437320 TGTCTTCAGCAAGAATCTTGGGG - Intergenic
1144292477 17:13839646-13839668 TGTCTTCCTTATGAATTTAGGGG + Intergenic
1150200054 17:63345708-63345730 TTTCTTCTTCAAGAATGTTTTGG - Intronic
1150531178 17:65983493-65983515 TGACTCCCTCATGAATGTCTTGG + Intronic
1150545508 17:66153687-66153709 TTTCTTCCTCAAGATTGCCTTGG - Intronic
1152829335 17:82487542-82487564 GGTCTTCCTCAAGGCTGTCAGGG - Intronic
1153451409 18:5234097-5234119 TGTCTTCTTCAGGAGTGTCTTGG - Intergenic
1155381414 18:25226432-25226454 TGTGTTCCTGAAGAGTGTTGAGG + Exonic
1155427155 18:25718292-25718314 TCTTTTCTTTAAGAATGTCGAGG - Intergenic
1156565316 18:38182266-38182288 TTTCTTCCACAAGCATGTTGTGG - Intergenic
1156610146 18:38715816-38715838 TGTCCACCTGAAGAATGTCCAGG + Intergenic
1156765657 18:40651930-40651952 TATCTTCCTCCAGAATGTTTAGG + Intergenic
1158685921 18:59614456-59614478 TGTCTTCCCAAATAATGTCTGGG + Intronic
1158794797 18:60831804-60831826 TTTCTTCCTCAAGATTATCTAGG + Intergenic
1158996404 18:62924979-62925001 TATCTTCCTCAAGTATTTAGAGG - Intronic
1163462484 19:17447580-17447602 TGTTTCTCTCCAGAATGTCGGGG - Intronic
1168093829 19:54103121-54103143 CGCCTTCCTCAAGAATGCCTGGG + Exonic
1168202718 19:54828265-54828287 TGTTTAACTCAAGAATGCCGTGG + Intronic
1168238247 19:55076582-55076604 TGGCTTCCTCCTGAGTGTCGGGG - Intronic
931758169 2:65392837-65392859 TGTCTTCCTAAGGGTTGTCGGGG + Intronic
937307902 2:120883512-120883534 TGTCTTCTTCAAGGTTATCGTGG - Intronic
944043334 2:195380326-195380348 TTTTTTCCTCAAGATTGTCTTGG - Intergenic
945369875 2:209003694-209003716 TTTCTTCTTCAAGGCTGTCGTGG + Intergenic
946111936 2:217427424-217427446 TTTCTCCCTCACGAATGTCTGGG + Intronic
946507451 2:220317157-220317179 TGACTTCCTCAAAACTGTTGAGG + Intergenic
1169090641 20:2859609-2859631 TGTCTTCCACAAGGCTGTAGAGG - Intronic
1170435166 20:16319056-16319078 AGTCTTCCTCAAGAGTGTCAAGG + Intronic
1170881640 20:20301850-20301872 TGTCTTCTTCAAGAGGGTCTTGG + Intronic
1170984292 20:21243890-21243912 TGTCTTCCAGAAGACTGTTGAGG + Intronic
1171177619 20:23065012-23065034 CCTCTTCATCAAGAATGTCTTGG + Intergenic
1175456098 20:59115672-59115694 TCTCTTCCTCTAAAATGTCAGGG + Intergenic
1178231956 21:30796029-30796051 GATCTTCCTCAACACTGTCGTGG + Intergenic
1180721209 22:17910138-17910160 TGGCTTCAGCAAGAATGTCATGG - Intronic
950659331 3:14457075-14457097 TGTCATCCATAAGAATGTCTGGG + Intronic
951460633 3:22947735-22947757 TGCCTTCATCAGGAATGTGGTGG + Intergenic
951539825 3:23772005-23772027 TGTCTTCATCAGGTATGTGGTGG - Intergenic
953120984 3:40041542-40041564 TGTATTCTTCAAAAATGTCATGG + Intronic
953209334 3:40860958-40860980 TTTCTTCTTCAACAATGTCTTGG + Intergenic
953510732 3:43535575-43535597 TTCCTTCCTTAAGAATGTCTAGG - Intronic
955483941 3:59417045-59417067 AGTATTCCTCAAGACTGTCAAGG + Intergenic
960432814 3:117590569-117590591 TGTGTTCCTTAAGATTGTCAAGG - Intergenic
962587310 3:136855174-136855196 TGTCTTCATCAACAATGTTTGGG - Exonic
963788447 3:149558753-149558775 TATATTCCTCAAAAATGTCAAGG + Intronic
964013256 3:151916400-151916422 TGAACTCCTCAAGAATGTGGAGG + Intergenic
964354206 3:155834896-155834918 TGTATTCTTCAAAAATGTCAAGG + Intronic
965272237 3:166632654-166632676 TTTCTTACTCAAGAAAGTCAGGG - Intergenic
969025265 4:4167716-4167738 TGTCTTCATCAACAGTGTCCAGG + Intergenic
970792064 4:19869090-19869112 TTTCTTCCTCAAGATTGTTTTGG + Intergenic
971602907 4:28618455-28618477 TATATACCTCAAAAATGTCGAGG + Intergenic
985916199 5:2920728-2920750 GGTCATCCTGAAGAATGTAGAGG - Intergenic
986730828 5:10633723-10633745 AGTCCTCCTCAAAACTGTCGAGG - Intronic
987771901 5:22315934-22315956 TGTCTTACTCTATAATGTCAGGG + Intronic
987933021 5:24427137-24427159 TGTCTTTCTCAAGATTTTTGGGG + Intergenic
988103225 5:26708788-26708810 CATCTTCCTCAAGACTGTTGTGG - Intergenic
989544438 5:42656708-42656730 TGCCTTCTTCAAGAATGTTTTGG + Intronic
990676923 5:58197057-58197079 TGCTTTGCTCAAGAATGTCCTGG - Intergenic
992197766 5:74356675-74356697 TTTCTTTCTCAAGAATCTCAAGG - Intergenic
992424361 5:76640929-76640951 TGACTTCCTCAATAATGTCCTGG - Exonic
992459548 5:76947555-76947577 TTTCTTTCTCAAGAATGTTTTGG - Intergenic
993846920 5:92955478-92955500 TTTCTTTCTCTAGAATGTCCTGG - Intergenic
996783925 5:127217757-127217779 TCTCATCCTCAAGAATATCATGG - Intergenic
999074663 5:148782730-148782752 TTTCTCCCTCAAGAATATCAAGG + Intergenic
1000255049 5:159529631-159529653 AGTCATAATCAAGAATGTCGAGG + Intergenic
1001587956 5:172845960-172845982 TGTCTTCCTCAAGGCTGCTGAGG - Intronic
1003959379 6:11194967-11194989 TGTTCTCCTCAAAGATGTCGTGG - Intronic
1004322329 6:14641804-14641826 TTTCTTCCTCAAAAATGACACGG + Intergenic
1004713809 6:18197444-18197466 TATTTTCCTAAAGAATGTGGTGG - Intronic
1008715164 6:54280236-54280258 TGTCTTCCTCAAGATTGTTTTGG - Intergenic
1010431828 6:75786338-75786360 GGTCTTCTTGAAGAATGTCTTGG + Intronic
1011364515 6:86567022-86567044 AGTATTCCTCAAAAATGTCAGGG + Intergenic
1014640169 6:123899711-123899733 TCTCTCCCTCAAGGATGTCCTGG + Intronic
1014773466 6:125482963-125482985 AATCTTCCTCAAGTATGTGGTGG - Intergenic
1015428403 6:133100302-133100324 TGTCTGCCTTTAAAATGTCGAGG - Intergenic
1015834259 6:137403098-137403120 TGCCTTCCTTAAAAATTTCGAGG - Intergenic
1018605148 6:165589320-165589342 TGTATTCCACAAGCATGTGGAGG - Intronic
1018912188 6:168108242-168108264 TCTCTTCCTCAAGAACACCGGGG - Intergenic
1019203421 6:170339486-170339508 TCTTTTCTTTAAGAATGTCGGGG + Intronic
1023465628 7:40451216-40451238 TTTCTTTCTCCAGAAAGTCGTGG + Intronic
1024428910 7:49262911-49262933 TGTTTTCCTCAAAAAAGTCTGGG + Intergenic
1026345658 7:69471856-69471878 AGTATTCCTCAAGACTGTCAAGG + Intergenic
1026763833 7:73147039-73147061 TGTCTTCCTGGAGAATGTCCTGG + Intergenic
1027040303 7:74956812-74956834 TGTCTTCCTGGAGAATGTCCTGG + Intergenic
1027083335 7:75245545-75245567 TGTCTTCCTGGAGAATGTCCTGG - Intergenic
1029390937 7:100273450-100273472 TGTCTTCCTGGAGAGTGTCCTGG - Intergenic
1029875751 7:103749813-103749835 TGTCTTCCTTCAGTATGTCTTGG + Intronic
1030856693 7:114566388-114566410 TGGATTCCTCATGAATGTCTTGG + Intronic
1030878964 7:114852598-114852620 TGTATTCCTCAAGGATCTCATGG + Intergenic
1031616759 7:123890559-123890581 TGTGTTCCTCAAGGATCTCAGGG - Intergenic
1038502976 8:28060816-28060838 TTTGTTCCTCAAGACTGTGGAGG + Intronic
1038843090 8:31204412-31204434 TGCCTTCCTAGAGAATGTCAGGG + Intergenic
1039947705 8:42144246-42144268 TGTGATCTTCAAGAATGTCAAGG - Intergenic
1040023183 8:42758662-42758684 TTTCTTCCTTAAGAAAGTCTTGG - Intronic
1040791292 8:51232834-51232856 TGACTTCCTCATGAATATGGAGG - Intergenic
1043693814 8:83192756-83192778 TGTCTCCCTCAAATATGTCCTGG - Intergenic
1043862556 8:85337202-85337224 TGTCATCCTCATGGATGTGGGGG - Intronic
1044728032 8:95208671-95208693 TCTCTTCCTGAGGAATGTGGTGG - Intergenic
1045479057 8:102578049-102578071 TGGCTTCCTCAAGTAGGTAGAGG + Intergenic
1046059791 8:109124627-109124649 GAACTTCCTCAAGAATGCCGTGG + Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047984597 8:130219759-130219781 TGCCTTCTGCAACAATGTCGTGG - Intronic
1048345385 8:133571492-133571514 TGTCTTCCACTAGAATCCCGGGG + Intronic
1050266190 9:3892403-3892425 TGTCTTCCTCAATATTGTCATGG - Intronic
1050312366 9:4366586-4366608 TGTGTTCCTCCAGAATGTGAAGG - Intergenic
1051241331 9:15059541-15059563 TGTATTCTTCAAAAATGTCAAGG + Intergenic
1055581883 9:77714482-77714504 TGTTTTCCTCAAGAATGCAAAGG - Intergenic
1056330372 9:85516396-85516418 TGTCTTCTTCCAGAATCTCCTGG + Intergenic
1056331081 9:85521932-85521954 TGTGTTCTTCAGGAATGGCGGGG - Intergenic
1057126795 9:92622824-92622846 TGTCTTCTTCAAGCATATCTTGG - Intronic
1057659771 9:96990398-96990420 AGTCCTCCTCAAGACTGTCCAGG + Intronic
1060935136 9:127510196-127510218 TGTCTTCTTCAAGGAGGTCACGG - Exonic
1187406930 X:19012817-19012839 GGTCTTCCTCTAGAATTTGGAGG - Intronic
1187532121 X:20106421-20106443 TCTCTTCTTCATGAATGTAGAGG - Intronic
1194137866 X:90169646-90169668 TGTCTTTCTCCAGAATTTGGGGG - Intergenic
1194758965 X:97771293-97771315 TTTCATTCTCAAGAATGTCCTGG - Intergenic
1195294971 X:103467172-103467194 TGTACTCCTCAAGACTGTCAAGG - Intergenic
1195301199 X:103531366-103531388 TGTACTCCTCAAGACTGTCAGGG + Intergenic
1195582440 X:106522833-106522855 TTTCTTCCTCAAGATTGTTTTGG + Intergenic
1196412636 X:115436090-115436112 TTGCTTCCTCAAAAATGTGGTGG + Intergenic
1196427261 X:115583689-115583711 TGTCTTCCTAAAAACTGACGAGG + Intronic
1199927196 X:152480152-152480174 TGTCCTCCTCAAGAAGGATGTGG + Intergenic
1200282930 X:154793981-154794003 TGTACTCTTCAAGAATGTCAAGG - Intronic
1201499934 Y:14630762-14630784 TGTCTTCCTCAAGAATGTCGAGG + Intronic