ID: 1201505601

View in Genome Browser
Species Human (GRCh38)
Location Y:14696065-14696087
Sequence CTGCATCTTCATGTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201505597_1201505601 7 Left 1201505597 Y:14696035-14696057 CCATCTTCCAATATGTTCATGCA 0: 1
1: 0
2: 1
3: 27
4: 233
Right 1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG 0: 1
1: 1
2: 1
3: 34
4: 266
1201505596_1201505601 19 Left 1201505596 Y:14696023-14696045 CCTTCTCAGGGACCATCTTCCAA 0: 1
1: 0
2: 4
3: 20
4: 177
Right 1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG 0: 1
1: 1
2: 1
3: 34
4: 266
1201505598_1201505601 0 Left 1201505598 Y:14696042-14696064 CCAATATGTTCATGCATGCATGC 0: 1
1: 0
2: 2
3: 27
4: 232
Right 1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG 0: 1
1: 1
2: 1
3: 34
4: 266
1201505595_1201505601 27 Left 1201505595 Y:14696015-14696037 CCATGCAGCCTTCTCAGGGACCA 0: 1
1: 1
2: 1
3: 29
4: 342
Right 1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG 0: 1
1: 1
2: 1
3: 34
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201505601 Original CRISPR CTGCATCTTCATGTCCAGCA GGG Intronic
900482237 1:2904954-2904976 CTGAATATTCATGCCCAGCCAGG - Intergenic
901530098 1:9847336-9847358 CTGTAACTTCTTGTCCAGAAAGG - Intergenic
901615993 1:10540182-10540204 CTTCAAGTTCATTTCCAGCAAGG - Intronic
901627385 1:10631823-10631845 CTGCTTCTTCAGGGACAGCAAGG - Intergenic
902413414 1:16225429-16225451 CAGCATCTTCATGTCCTTCTGGG - Intergenic
904756943 1:32773179-32773201 CTGCAGCCTCAGGGCCAGCAGGG - Exonic
904791133 1:33022256-33022278 CTGTTTCCTCATGTCCAGGATGG - Intronic
905061403 1:35142697-35142719 CAGCATATTCGTATCCAGCAAGG + Intergenic
906299297 1:44670514-44670536 CTGAAGCTTCAGGTCCAGCTTGG + Intronic
906656410 1:47551690-47551712 CTGCATCTGCATCTGCAACATGG - Intergenic
908816960 1:68044204-68044226 TTTCATTTTCATGACCAGCAAGG - Intergenic
916102538 1:161405449-161405471 CAGCATATTCATATCCAGCAAGG + Intergenic
917795162 1:178528090-178528112 CTTCATCTTCATCCTCAGCATGG + Intronic
918201262 1:182269307-182269329 CTGCATCTATTTGGCCAGCAGGG - Intergenic
921050612 1:211508797-211508819 CAGCATCTTCCTGCCCAACAAGG - Intergenic
922468187 1:225859234-225859256 CTCCATCATCCTGTCCACCATGG - Exonic
922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG + Intronic
924080535 1:240392942-240392964 ATGCACCTTCATTTCCAGAATGG + Intronic
1067133217 10:43585033-43585055 TGGCATATTCATATCCAGCAAGG + Intergenic
1067527580 10:47047752-47047774 CATCATCGTCATGGCCAGCAGGG + Intergenic
1069424003 10:68273627-68273649 TTGCATCCTCATAGCCAGCAAGG + Intergenic
1070964636 10:80522172-80522194 CTGCATCTTATATTCCAGCAGGG + Exonic
1072806270 10:98425646-98425668 CTTCAGCTTCTTCTCCAGCATGG + Exonic
1073651734 10:105367616-105367638 CTCCCTCTTCAAGTCCAGGAGGG + Intergenic
1074441410 10:113480298-113480320 TGGCATCTTCACGTCCATCAGGG + Intergenic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1074816163 10:117142271-117142293 AAGCATTTTCATGTCCAGTAAGG - Intergenic
1075312587 10:121427163-121427185 GTGCATCTTGATTTCCAGCCTGG + Intergenic
1075778842 10:125004240-125004262 CTGCATCTAGACGTTCAGCAGGG + Intronic
1077258783 11:1604421-1604443 CTGCCTGTGCATGCCCAGCAAGG - Intergenic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1080270961 11:30450229-30450251 CTGCATCTTCAGGTCTGACAAGG - Intronic
1080276354 11:30507447-30507469 ATGCAGCTTCCTGTCCAGCGTGG - Intronic
1081512085 11:43785294-43785316 CAGCATATTCATATCTAGCAAGG + Intronic
1081782827 11:45725153-45725175 TTCCTTCTTCATTTCCAGCAGGG - Intergenic
1083191405 11:61055104-61055126 CTGCCTCTTCATCTCTACCATGG + Intergenic
1084298034 11:68225884-68225906 CTGCTTCTCCACGTCCAGGATGG + Intergenic
1084390374 11:68871848-68871870 CAGCATATTCATATCCAGCAAGG - Intergenic
1084621695 11:70275183-70275205 CTGCATGTTCCTGGCCATCAGGG - Intronic
1084632693 11:70364720-70364742 CAGCACCTTCATTTTCAGCAAGG - Intronic
1084655702 11:70516397-70516419 TTGCATGTGGATGTCCAGCATGG - Intronic
1084724160 11:70929553-70929575 CTCCATCTTCAAGACCAGCATGG + Intronic
1085871872 11:80359741-80359763 CTGCATCTTCACGTTGAGTAAGG + Intergenic
1086733057 11:90272461-90272483 CCTCATCTTCATGTGCATCAGGG - Intergenic
1087382028 11:97417498-97417520 CTGCACCTTCATGTCCCACAAGG + Intergenic
1089314746 11:117583752-117583774 CTGCATCTTCATCCACAGAATGG + Intronic
1090520679 11:127475631-127475653 CTGCATCTTCCAGTCTACCACGG - Intergenic
1090730827 11:129572160-129572182 CAGCCCCTGCATGTCCAGCAGGG - Intergenic
1090918187 11:131185567-131185589 CTGCAACCACATGGCCAGCAGGG - Intergenic
1094564539 12:31588216-31588238 CTGCTTCCTCATGTCCTTCAAGG + Intronic
1094691495 12:32773863-32773885 CTGCATTTTCACAGCCAGCAGGG - Intergenic
1096820223 12:54227923-54227945 CTGCTTCTACATCTGCAGCAAGG - Intergenic
1096854602 12:54471245-54471267 CAGCTTCTTCATTTCCAACATGG - Exonic
1097144754 12:56932326-56932348 CTCCATCTTCAAGGCCCGCAAGG - Intronic
1097151617 12:56983516-56983538 CTGCATCTCCAAGTACAGCGTGG - Intergenic
1097712359 12:62930992-62931014 CTGCAACCTCAAGTCTAGCAGGG + Intronic
1098491023 12:71078302-71078324 CTGCATCTTGATGTGCAAAATGG - Intronic
1099415147 12:82375319-82375341 CTACATCTTCACATGCAGCAGGG - Intronic
1104064000 12:125291467-125291489 CTCCATCTTCAGAGCCAGCATGG - Intronic
1104870135 12:131989093-131989115 CAGCATCCACATGTCCAGCCTGG - Intronic
1104917814 12:132275065-132275087 CAGCTTCTCCATGTCCAGCCCGG + Intronic
1105051873 12:133061287-133061309 CAGCATGTTCATGGCCAACATGG + Exonic
1107510749 13:41081656-41081678 CTGCACCTGCCTGGCCAGCAAGG - Intronic
1107790476 13:43997231-43997253 CTGCATTCTCATGTACACCAGGG + Intergenic
1109011225 13:56947595-56947617 CTCCATCTTCAAAGCCAGCAAGG + Intergenic
1110408383 13:75176273-75176295 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
1111271926 13:85897049-85897071 CTCCACCTACATGTCCAGGATGG - Intergenic
1112332136 13:98484834-98484856 CTCCATCTTCCTCTCCAGGAAGG - Intronic
1112813175 13:103242742-103242764 CTGTATCTTCTTCTTCAGCAGGG + Intergenic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1114574154 14:23697235-23697257 CAGCATATTCATATCCAGCAAGG - Intergenic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1116049529 14:39786065-39786087 CTGCATCTTCATGTTGAATAGGG + Intergenic
1116989630 14:51261859-51261881 CTGCACCTTCTTGACCAGCAAGG - Intergenic
1117703367 14:58437751-58437773 CTGCATCTTAATTTCCAGCTTGG - Intronic
1118951365 14:70439197-70439219 CAGCATCTTTATACCCAGCAAGG + Intergenic
1119558497 14:75571458-75571480 CAGCATCTACATGTCCAGCTAGG + Intergenic
1120280893 14:82436560-82436582 CTCCATCTTGAAATCCAGCAAGG - Intergenic
1120667114 14:87319181-87319203 CAGCATCTTCATCTCTAACATGG + Intergenic
1126408705 15:48349731-48349753 CTGCGTCTTCACCTCCAGCAGGG + Intergenic
1126870813 15:52984794-52984816 CTACATCTTCATGTCCTGCAGGG - Intergenic
1126872951 15:53009288-53009310 TTGCTTCTTCAAGGCCAGCAGGG - Intergenic
1128207679 15:65867818-65867840 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1128495519 15:68196351-68196373 CTGTACCCTCATTTCCAGCAAGG + Intronic
1129841944 15:78749151-78749173 GTGCATCATCATGCCCTGCAGGG - Intergenic
1130023824 15:80253173-80253195 CTTCATTTTAATATCCAGCAGGG - Intergenic
1130330922 15:82921683-82921705 CTGAGTCTGCAGGTCCAGCAAGG - Intronic
1130712095 15:86293421-86293443 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1131652899 15:94421594-94421616 CTCCATCTTCAGATCCAGCAAGG + Intronic
1131814358 15:96206958-96206980 CTGCATCTACATGGTCAGCGGGG + Intergenic
1132684016 16:1154715-1154737 CTGCCTCTTCCTCTCCAGCCAGG - Intronic
1132716004 16:1290081-1290103 CTGCAGCTCTGTGTCCAGCAGGG - Intergenic
1135111074 16:19691286-19691308 CTGCCTCTCCCTGGCCAGCATGG + Intronic
1136111179 16:28064202-28064224 CTGCCACTCCAAGTCCAGCATGG - Intergenic
1136136100 16:28257878-28257900 CTGTGTGTCCATGTCCAGCATGG + Intergenic
1138778320 16:59752441-59752463 CTCCATCTTCTTAACCAGCAAGG + Intronic
1139948390 16:70657092-70657114 CTGCTGCTGAATGTCCAGCAGGG + Exonic
1142160380 16:88554512-88554534 CTCCATCTTCAGAGCCAGCAGGG + Intergenic
1142947619 17:3446061-3446083 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1143188026 17:5022309-5022331 CTGCATCTTCAGGTCAGCCATGG - Exonic
1143292472 17:5842211-5842233 ATTCTTCTTCATATCCAGCAGGG - Intronic
1143339567 17:6200137-6200159 CTGCATCTCCATGTTCAGGAGGG - Intergenic
1144083445 17:11785239-11785261 CTGCAGATTCTTGTCCAGAATGG - Intronic
1144850276 17:18240698-18240720 CTGCACCTCCTTGCCCAGCACGG - Exonic
1146379961 17:32321195-32321217 CGGCAGCTTTAAGTCCAGCAGGG - Exonic
1146903556 17:36603111-36603133 CTGCCTCCTTGTGTCCAGCAAGG - Intronic
1147544679 17:41392054-41392076 CTCCATCTTCAAATCCTGCAAGG + Intronic
1149957982 17:61074984-61075006 CTTCATCTTCCTGTCCACTATGG - Exonic
1152616320 17:81339558-81339580 CTGCATCTCCTTCTCCTGCATGG - Intergenic
1154171835 18:12057720-12057742 CTGCATCTTCAGGTCAGGCATGG + Intergenic
1154404272 18:14074363-14074385 CTGCACCCTGATGGCCAGCAGGG + Intronic
1156105373 18:33653191-33653213 CTGCATCTTTGTGTTCAGGAGGG + Intronic
1156500528 18:37554560-37554582 ATTCATCATCATGCCCAGCATGG + Intronic
1156595257 18:38541460-38541482 CTCCATCTTCCTCTCCACCATGG + Intergenic
1157843313 18:50979474-50979496 TTGCTTCTTCATAGCCAGCATGG + Intronic
1159541637 18:69784920-69784942 CTGCATTTTCAGCACCAGCATGG - Intronic
1160200888 18:76794303-76794325 CTGCTTCTTCCTGTCCCCCAGGG + Intergenic
1160619411 18:80160307-80160329 CGGCATCTTCATCTCGCGCATGG - Exonic
1163786879 19:19279328-19279350 CAGCAGCTGCATGTCCTGCATGG + Exonic
1163861310 19:19744376-19744398 CTTCATCTTCATGACCTCCAGGG - Intergenic
1163953817 19:20615439-20615461 CAGCATATTCATATCCAGCAAGG - Intronic
1164094676 19:21996609-21996631 CTGCAAATTCAGGTCCTGCATGG + Intronic
1164114247 19:22202087-22202109 CTGCAAATTCAGGTCCTGCATGG + Intergenic
1164198390 19:22993943-22993965 CTGCAAATTCAGGTCCTGCATGG + Intronic
1165061698 19:33208003-33208025 CACCCTCTTCCTGTCCAGCAAGG + Exonic
1165429568 19:35764876-35764898 CAGCGTCTCCAGGTCCAGCAGGG - Exonic
1166510620 19:43406486-43406508 CTCCATCTTCAGTTCCCGCATGG + Exonic
1166648877 19:44555147-44555169 CTGCATCTTCAAAGACAGCAAGG - Intergenic
1166820543 19:45576699-45576721 CTCCATCTTCAAGGCCAGCGGGG + Intronic
1167603144 19:50466102-50466124 CTGCATCCACATGACCAGCAGGG - Intronic
1167797269 19:51717648-51717670 TTGCCTCTTCAAGGCCAGCAAGG - Intronic
1167999780 19:53435774-53435796 CAGCATGTTCATATCCAGCAAGG + Intronic
1168004207 19:53473087-53473109 CAGCATGTTCATATCCAGCAAGG + Intronic
926635042 2:15169720-15169742 CTGTATCCCCATGTCCAGAATGG + Intronic
927829689 2:26338775-26338797 TTGTATCTCCATGTCCATCATGG + Intronic
927906831 2:26864622-26864644 CTGCATCCTAATGGCCAGGATGG - Intronic
932404263 2:71503288-71503310 CTGCTTCTTGGTGTCCAGCAGGG - Exonic
932512733 2:72311430-72311452 CTCCATCTTCAAAACCAGCAGGG + Intronic
932763074 2:74452634-74452656 CTGCATCATGATGCCCAGCAGGG - Intergenic
932823489 2:74920806-74920828 CTCCCTCTCAATGTCCAGCAGGG + Intergenic
932857320 2:75249743-75249765 CAGCATATTCATTTACAGCATGG - Intergenic
933590952 2:84231760-84231782 CTGCGTTTTCATCTCCAGCAGGG + Intergenic
937861351 2:126713940-126713962 CTGCATCTTCAGGACCATCTTGG - Intergenic
938748941 2:134310232-134310254 CATCATCTTCATGTTCTGCATGG - Intronic
939130244 2:138226637-138226659 TTGCATCTTCATGGACAGAATGG + Intergenic
939254247 2:139721910-139721932 CTGCAGCTTGAAGCCCAGCAGGG - Intergenic
942811865 2:180009239-180009261 TTGAATCTTCATGTCCACCTTGG - Intergenic
944774645 2:202950509-202950531 TTGCCTTTTAATGTCCAGCAGGG + Intronic
946724312 2:222647185-222647207 CTGCATCATTATGTCCTGGAAGG - Intronic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
948183703 2:236002628-236002650 CTGCATCTTCTTGTCCCTCCTGG + Intronic
948328475 2:237145715-237145737 CAGCTTCTTCATTTCCAGAATGG + Intergenic
1168849020 20:963995-964017 CTGCCTCCTCATGCCCAGCCCGG + Exonic
1169325312 20:4670896-4670918 CTCCATCTTCATGTCCAGAGGGG - Intergenic
1170396381 20:15930484-15930506 GTGCATCCTCAAATCCAGCAGGG - Intronic
1170473629 20:16692481-16692503 CTCCTTCTACATGTCCATCAAGG + Intergenic
1171227931 20:23456809-23456831 CTGCATCATCAAAGCCAGCATGG + Intergenic
1173875423 20:46367459-46367481 CTTCATCTCCATGCTCAGCAGGG + Exonic
1173934491 20:46849520-46849542 CTGCAGCTTCATTTCAATCAGGG + Intergenic
1174750790 20:53109511-53109533 CTACGTCTTCAGGTCCAGCTAGG - Intronic
1174962414 20:55173672-55173694 CTGCTTCTTCAGGTCCAGGGTGG - Intergenic
1175191487 20:57214932-57214954 CTGCATCCTTATGGCCAGTAAGG + Intronic
1175543615 20:59763736-59763758 CTGCATCTGAATGTCCACCTGGG - Intronic
1175736519 20:61391067-61391089 CTGCTTCTTTTTGTCCTGCATGG + Intronic
1175764144 20:61581463-61581485 CTCCATCTTCATGGCCAGTGAGG + Intronic
1177452847 21:21294278-21294300 GTGAATCTTCATGCCCATCATGG + Intronic
1177566584 21:22830873-22830895 CTGCTTCTTCATGTAAAGCAGGG - Intergenic
1178258118 21:31073967-31073989 CTCCATCTTCAAAGCCAGCAGGG + Intergenic
1178608572 21:34059898-34059920 CTGCCTCTACATGCCCACCATGG - Intergenic
1179246572 21:39638576-39638598 CTGATTCTTCAGGTACAGCAAGG + Intronic
1182083554 22:27545693-27545715 CAGTACCTACATGTCCAGCAAGG + Intergenic
1184438716 22:44496191-44496213 CTGCATATTCATGTGCAGAGTGG + Exonic
1184719049 22:46298668-46298690 TTGCATCTTCATATCTAGCAAGG + Intronic
1185302218 22:50087872-50087894 CGGCCTCATCATGTCCAGAATGG - Intergenic
950170829 3:10838109-10838131 CCTCATCTTCATGTCGTGCACGG - Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
952507507 3:34020628-34020650 CTCCCACTTCATGTCCATCATGG - Intergenic
953897510 3:46813469-46813491 CTGCATCTTCAAGTCCTTGATGG + Intergenic
954309126 3:49751063-49751085 CTGCATCTGCAAATCCTGCAGGG - Intronic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955604641 3:60688374-60688396 CTGAATATTGATGTTCAGCAAGG - Intronic
957032519 3:75258084-75258106 CTCCATCTTCAAAACCAGCAAGG + Intergenic
960177492 3:114533917-114533939 CAGCATTTTCTTGTCCATCAAGG - Intronic
962706989 3:138053108-138053130 CTGCATCTTTACATCCAGCAGGG + Intergenic
963122347 3:141786934-141786956 CTCCATCTTCAAAGCCAGCAGGG - Intronic
964255898 3:154773570-154773592 CTGCTTCTTCTTGGCCACCATGG + Intergenic
964383088 3:156118307-156118329 CTGCATGTGGCTGTCCAGCAAGG + Intronic
965544639 3:169903152-169903174 CTTGATCTTGATGTTCAGCAGGG + Intergenic
968892276 4:3375759-3375781 CTCCAGCCTCATCTCCAGCACGG + Intronic
968953671 4:3707477-3707499 CTGCATCTTCATGGCATCCAAGG - Intergenic
969834880 4:9832452-9832474 CTCCATCTGTATGTCCAGCCTGG + Intronic
971873937 4:32280025-32280047 CTGCATCTGCATGTTCATCATGG + Intergenic
972339889 4:38142966-38142988 CTGCCTCTCCATATCCAGCTCGG + Intergenic
972416464 4:38845547-38845569 CTTTATCTTCAGGGCCAGCAAGG - Intronic
972761028 4:42104597-42104619 CTCCATCTTCAAAACCAGCATGG + Intergenic
972902610 4:43703311-43703333 CTGCATCTTCATCTGCATTAGGG + Intergenic
973567376 4:52201859-52201881 CTCCATCTTCACAGCCAGCAAGG - Intergenic
976863007 4:89689176-89689198 CTGCATCTTCAAAGCTAGCAAGG + Intergenic
977845330 4:101760563-101760585 CTGCATTTTCATACCCAGGATGG + Intronic
978296691 4:107213493-107213515 CTACATTTTCATGGGCAGCAAGG + Intronic
979099180 4:116593549-116593571 CTCCATCTTCAACTCCAGCAGGG + Intergenic
979502709 4:121458377-121458399 CTCCATTTTCAGGGCCAGCAGGG - Intergenic
979779952 4:124638269-124638291 CTGCATCTTCATGCACATCAAGG + Intergenic
980079998 4:128334099-128334121 CTGCTTCTTCATCTAAAGCATGG - Intergenic
980100914 4:128540364-128540386 CTGCATCTTTAAAGCCAGCAGGG + Intergenic
980613341 4:135185648-135185670 CTGAATCTTCATCACCAGGATGG - Intergenic
982244560 4:153337911-153337933 CTGCCTCCCCATGTCCAGCAAGG - Exonic
982872959 4:160607344-160607366 TTGCTTCTTCAGGTCCAGAAGGG - Intergenic
983206479 4:164915679-164915701 CTGCATCATTATGTCCTGGAAGG + Intergenic
983212145 4:164969867-164969889 CTGCATCATTATGTCCTGGAAGG - Exonic
983906521 4:173188692-173188714 TTTCATGTTCATGTGCAGCATGG + Intronic
984905799 4:184624796-184624818 GTGGATCTTCACGTCCATCAGGG + Intergenic
985531106 5:434257-434279 TTGCAGCTTCATGTCCTCCATGG - Exonic
985827617 5:2204756-2204778 CTGGAGCTTCCTGTCCAGGACGG + Intergenic
987385480 5:17325105-17325127 CTCCATCTTCAAAGCCAGCATGG - Intergenic
987651566 5:20748066-20748088 CTTGATCTTCATGTACAGAAAGG + Intergenic
987938898 5:24506241-24506263 CTGCAACTTGATTGCCAGCATGG + Intronic
988743995 5:34113412-34113434 CTTGATCTTCATGTACAGAAAGG - Intronic
989299916 5:39878694-39878716 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
992021950 5:72633658-72633680 CAGCATCTTGAAGTCCTGCAGGG + Intergenic
993620537 5:90162690-90162712 CTGGTTCTGCATGCCCAGCAAGG + Intergenic
994095630 5:95844954-95844976 CTGGATTATCATCTCCAGCATGG + Intergenic
994727970 5:103458896-103458918 CTGATTCTTCATGTCCATAAGGG + Intergenic
995336161 5:111002163-111002185 CTGCATATACAAGTCCAGCCTGG + Intergenic
996624757 5:125557317-125557339 CTCCATCTTCAAAGCCAGCAGGG + Intergenic
996625142 5:125562079-125562101 CTGCACCTCTAGGTCCAGCACGG - Intergenic
996901943 5:128552512-128552534 CTGCATCTATCTCTCCAGCAAGG + Intronic
998046801 5:138993617-138993639 CTGCTTCTTCAGAGCCAGCAAGG - Intronic
998929350 5:147163481-147163503 CTGCAGTCTCATGTGCAGCAGGG - Intergenic
999210664 5:149885884-149885906 CTCCATCTTCAAAGCCAGCAGGG + Intronic
1000721083 5:164708022-164708044 CTACATCATGATTTCCAGCATGG - Intergenic
1002326912 5:178415712-178415734 CTGCATCCCCTTGTGCAGCAGGG - Intronic
1004503293 6:16227517-16227539 CAGCATATTCATATCCAGCAAGG + Intergenic
1007090590 6:39182161-39182183 CTGCTTCTTCCTTTCCAGGATGG + Intergenic
1007414814 6:41685064-41685086 CTGCATCTCCAGCTCCTGCAGGG + Exonic
1007764698 6:44153742-44153764 GTGGATCTTCTTGTCCAGCTTGG - Exonic
1008160234 6:48068224-48068246 GTTCACCTTCATTTCCAGCACGG + Exonic
1008583364 6:52926312-52926334 CAGTATATTCATATCCAGCAAGG - Intergenic
1009966381 6:70582959-70582981 ATTCATCTTTATGTCAAGCAGGG - Intronic
1011570970 6:88734582-88734604 CTGCATCTTTATGTCTAAAATGG - Intronic
1012035706 6:94135957-94135979 ATGCATCTTTATGTACAGCTCGG - Intergenic
1013705275 6:112826009-112826031 ATGGATCTTCATGAGCAGCAAGG - Intergenic
1014219229 6:118783208-118783230 ATTCATCTACTTGTCCAGCATGG - Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1017463901 6:154676826-154676848 CAGAATCTTCAGGTCGAGCACGG - Intergenic
1018657313 6:166050705-166050727 CTCCATCTTCAAGACTAGCAGGG - Intergenic
1019029244 6:168995898-168995920 ATGCATCTTCAAGTCCTGCCGGG - Intergenic
1019328435 7:451068-451090 CCCCAACTTCATGTCCAGGAGGG + Intergenic
1019865220 7:3702457-3702479 GTGCTTATTCATGTCCAGTATGG - Intronic
1019957278 7:4425298-4425320 CTGGATCTTCATCTCCACCCAGG - Intergenic
1020996999 7:15278221-15278243 CTGCTGCTTCATGTACAGAAGGG + Intronic
1022667728 7:32427830-32427852 CTGCGGCTTCGTGGCCAGCAGGG + Intergenic
1023030655 7:36087977-36087999 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
1023803252 7:43852954-43852976 CTCCATCTTCAATGCCAGCAGGG + Intergenic
1024556709 7:50610018-50610040 CAGCATCTTCATATCAACCATGG - Intronic
1027056956 7:75056212-75056234 CTGCATGTTCTTGCCAAGCAAGG - Intronic
1027400616 7:77802117-77802139 CTGCCTCTTCCTGTTCTGCATGG - Intronic
1030236047 7:107263265-107263287 ATTCATCTACATGTTCAGCAAGG + Intronic
1030253222 7:107474074-107474096 CTGCATGTTGATTTCCAGAATGG - Exonic
1030360532 7:108590623-108590645 CTCCATCTTCAAAGCCAGCAAGG - Intergenic
1031132069 7:117844111-117844133 CTCCATCTTCAAGGCCAGCAGGG - Intronic
1032315203 7:130831370-130831392 CTCCATCTTTATATCCATCATGG + Intergenic
1032715256 7:134503788-134503810 CTGCATCTGGAAGTCCAGCCAGG - Intergenic
1032793303 7:135258273-135258295 CTGCATTTTCACCTCCAGCTTGG - Intronic
1033330556 7:140413790-140413812 CTGCATCTACCTGTCCACCCCGG - Intronic
1034974767 7:155441582-155441604 GAGCATCTTCACGTCCTGCAGGG - Intergenic
1035966953 8:4203198-4203220 CTCCATCTTCAAAGCCAGCAAGG - Intronic
1041008738 8:53520979-53521001 CAGCATATTTATATCCAGCAAGG + Intergenic
1042148228 8:65754767-65754789 CTTCATCTTCTTGGCCAGGATGG - Intronic
1044000100 8:86868984-86869006 CTCCATCTTCAAAGCCAGCAAGG - Intronic
1047377649 8:124317808-124317830 CTGCATCTTCAGAGCCAGCAAGG - Intronic
1049283635 8:141763010-141763032 CCGCAGCTCCCTGTCCAGCAGGG + Intergenic
1050276831 9:4009427-4009449 CTGCACCTTGCTGGCCAGCAGGG - Intronic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055956304 9:81776701-81776723 TTGCATCTCCGTGTCCACCATGG + Intergenic
1057296996 9:93852266-93852288 CTGCCTCTTCATCAGCAGCATGG - Intergenic
1057300788 9:93880392-93880414 CAGCATCTTTATGTCTAGCTAGG + Intergenic
1059353687 9:113683896-113683918 CTCCGCCTTCATGCCCAGCAGGG - Intergenic
1060638709 9:125220665-125220687 ATGCAGCTTCGTGTCCTGCACGG - Exonic
1061361054 9:130142549-130142571 CTGCGTCTTCGGGGCCAGCAGGG - Intergenic
1061747247 9:132749496-132749518 CTGCGTCTTCATGGCAAGCCCGG + Intronic
1061794576 9:133078406-133078428 CAGCGTATTCATATCCAGCAAGG + Intronic
1062249504 9:135587233-135587255 CTGTACCTTCCTGTCCAGCTGGG - Intergenic
1062527641 9:136984764-136984786 CCGCATCTCCAAGTACAGCAAGG - Exonic
1185980348 X:4772257-4772279 GTGCATCTTCCTGTCCAGTGTGG + Intergenic
1186141153 X:6575363-6575385 CAGTTTCTTCATGTCCAGCGAGG + Intergenic
1186159699 X:6764060-6764082 TTTCATCTTCATATCCAGTAGGG + Intergenic
1186589489 X:10914942-10914964 CTCCAACTTCATGTCCATTAAGG + Intergenic
1188305381 X:28555587-28555609 CTATATCTTCATGTTCATCAGGG + Intergenic
1189636887 X:43020508-43020530 CTGCATCTTCACATACAGGAAGG - Intergenic
1190246055 X:48691120-48691142 CTTCATCTTCATCGCCAGCCTGG - Exonic
1192568141 X:72180370-72180392 AAGCATCTCCAGGTCCAGCAAGG + Intergenic
1195511096 X:105716070-105716092 CTGTATTTTCATCTACAGCAGGG - Intronic
1195551014 X:106171063-106171085 CTCCAGCTGCTTGTCCAGCAGGG - Exonic
1195554285 X:106204090-106204112 CTCCAACTGCTTGTCCAGCAGGG - Exonic
1195636707 X:107125125-107125147 CTTCATCTTCATGTTGAACAGGG - Intronic
1198069276 X:133131881-133131903 TTGCTTCTTCAAGGCCAGCAAGG - Intergenic
1199056050 X:143296226-143296248 CTGTATCTTTATGTCCTACAGGG - Intergenic
1199482385 X:148311802-148311824 ATGCATTTGCATCTCCAGCATGG + Intergenic
1199735320 X:150680667-150680689 CTCCATCTTCAAAGCCAGCATGG - Intergenic
1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG + Intronic
1201553380 Y:15242601-15242623 TTCCATCTTCATATCCAGCAGGG + Intergenic
1201622165 Y:15972052-15972074 CAGTTTCTTCATGTCCAGCGGGG - Intergenic