ID: 1201525732

View in Genome Browser
Species Human (GRCh38)
Location Y:14931952-14931974
Sequence TAACCCTGGTTTTCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201525730_1201525732 8 Left 1201525730 Y:14931921-14931943 CCTGGAATAGTTGTTGAAGATGC No data
Right 1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG No data
1201525728_1201525732 28 Left 1201525728 Y:14931901-14931923 CCTGAAAGGTAAAGATCTTACCT No data
Right 1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201525732 Original CRISPR TAACCCTGGTTTTCAGCAAC AGG Intergenic
No off target data available for this crispr