ID: 1201529425

View in Genome Browser
Species Human (GRCh38)
Location Y:14976086-14976108
Sequence GCCCTGTGAATAAGATCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201529425_1201529431 23 Left 1201529425 Y:14976086-14976108 CCCATTGATCTTATTCACAGGGC No data
Right 1201529431 Y:14976132-14976154 AATAGGTCTCCTGTGTGCCATGG No data
1201529425_1201529428 6 Left 1201529425 Y:14976086-14976108 CCCATTGATCTTATTCACAGGGC No data
Right 1201529428 Y:14976115-14976137 ATGCTATGAGACACCCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201529425 Original CRISPR GCCCTGTGAATAAGATCAAT GGG (reversed) Intergenic
No off target data available for this crispr