ID: 1201530470

View in Genome Browser
Species Human (GRCh38)
Location Y:14985566-14985588
Sequence TGTGTGGGGGAGATTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201530470_1201530479 24 Left 1201530470 Y:14985566-14985588 CCTCCTCTAATCTCCCCCACACA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530470_1201530480 25 Left 1201530470 Y:14985566-14985588 CCTCCTCTAATCTCCCCCACACA No data
Right 1201530480 Y:14985614-14985636 ATGGTACCACAAAACCTCCTGGG No data
1201530470_1201530477 6 Left 1201530470 Y:14985566-14985588 CCTCCTCTAATCTCCCCCACACA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201530470 Original CRISPR TGTGTGGGGGAGATTAGAGG AGG (reversed) Intergenic
No off target data available for this crispr