ID: 1201530477

View in Genome Browser
Species Human (GRCh38)
Location Y:14985595-14985617
Sequence AACAAGCAAAGAAATCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 28, 1: 29, 2: 14, 3: 53, 4: 491}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201530469_1201530477 21 Left 1201530469 Y:14985551-14985573 CCTATTAATGATAAGCCTCCTCT 0: 99
1: 91
2: 48
3: 31
4: 104
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530467_1201530477 26 Left 1201530467 Y:14985546-14985568 CCCTTCCTATTAATGATAAGCCT 0: 96
1: 81
2: 50
3: 26
4: 144
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530476_1201530477 -10 Left 1201530476 Y:14985582-14985604 CCACACAGAAGGAAACAAGCAAA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530471_1201530477 3 Left 1201530471 Y:14985569-14985591 CCTCTAATCTCCCCCACACAGAA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530466_1201530477 27 Left 1201530466 Y:14985545-14985567 CCCCTTCCTATTAATGATAAGCC 0: 90
1: 92
2: 49
3: 24
4: 103
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530470_1201530477 6 Left 1201530470 Y:14985566-14985588 CCTCCTCTAATCTCCCCCACACA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530475_1201530477 -9 Left 1201530475 Y:14985581-14985603 CCCACACAGAAGGAAACAAGCAA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530473_1201530477 -7 Left 1201530473 Y:14985579-14985601 CCCCCACACAGAAGGAAACAAGC No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530474_1201530477 -8 Left 1201530474 Y:14985580-14985602 CCCCACACAGAAGGAAACAAGCA No data
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491
1201530468_1201530477 25 Left 1201530468 Y:14985547-14985569 CCTTCCTATTAATGATAAGCCTC 0: 97
1: 85
2: 54
3: 22
4: 105
Right 1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG 0: 28
1: 29
2: 14
3: 53
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201530477 Original CRISPR AACAAGCAAAGAAATCTCCA TGG Intergenic
901839134 1:11942954-11942976 AACAAACAAAAAAAACTCCCGGG - Intronic
901865793 1:12105949-12105971 AAAAAAAAAAGAAAACTCCAGGG + Intronic
902663653 1:17922509-17922531 AACAAACAAAGAAATATATAAGG - Intergenic
903043094 1:20546769-20546791 AAGAAGCAAAGGAAACTCCCAGG + Intergenic
906491734 1:46273856-46273878 AATAAGGGAAGATATCTCCAGGG - Intronic
906766628 1:48440131-48440153 AACAAGCAAAGACATCTCCAAGG + Intronic
907128105 1:52070402-52070424 ACCAAACAAAGAAAAATCCAAGG + Intronic
907418508 1:54330745-54330767 AACCAGCCCAGAAATCTCCCAGG + Intronic
908298486 1:62737172-62737194 AACAAGCAAACAAAAATCAAAGG - Intergenic
908642029 1:66234821-66234843 AAAAAGCAAATAAATCACAAAGG - Intronic
908659810 1:66423953-66423975 AACAAGCAAAGAAATCTCCAAGG - Intergenic
909412928 1:75375552-75375574 AACAAGAAAAGAAATCTTAAAGG + Intronic
909432848 1:75609682-75609704 AACAAGAAAAGAGAACTTCAGGG + Intronic
910156680 1:84226760-84226782 AACAAGACAAGAAAGCTCAAGGG - Intronic
910724454 1:90323824-90323846 AACAAACAAAAAAAACCCCATGG - Intergenic
911195037 1:94985899-94985921 AAAAAGCAAACTAATCTCAAAGG + Intronic
911278850 1:95898001-95898023 AACAAGACAAGAATTGTCCATGG + Intergenic
911407009 1:97453490-97453512 AATAAGGAAAAAAATCTTCATGG + Intronic
911467009 1:98267834-98267856 AACAGGAAGAGAAAACTCCATGG + Intergenic
911744615 1:101426810-101426832 AACAAAAAAAGAAAACTCCAGGG - Intergenic
912559773 1:110542185-110542207 ACAAAGGAAAGAAATCTCCACGG - Intergenic
912574269 1:110650787-110650809 AACTAGCAAACAGAACTCCAGGG - Intergenic
912974167 1:114312891-114312913 ATCAAGAAATGATATCTCCAAGG + Intergenic
913314515 1:117538773-117538795 AACAAACAACCCAATCTCCAGGG - Intergenic
913382567 1:118227676-118227698 AACAAGGAAAGAAATCTCCAAGG + Intergenic
913645705 1:120851914-120851936 AACAAGCAAAAAAACATCTAGGG + Intergenic
913713452 1:121510700-121510722 AACAAGGAAAGAAATCTCCAAGG + Intergenic
915018980 1:152761718-152761740 AACAAGCAAAGAAGGCTCCAAGG - Exonic
915801825 1:158801768-158801790 AATATGGAAAGAAAACTCCAGGG - Intergenic
916083573 1:161252268-161252290 AGGAAACAAATAAATCTCCAAGG + Intergenic
916649123 1:166818570-166818592 AACAAGCTAAGAATTCTACAAGG + Intergenic
916939473 1:169664151-169664173 AACAAGCAAAGAAATCTCCAAGG + Intronic
917086077 1:171306993-171307015 AACAAGCAAAGAAATCTCCAAGG + Intergenic
917279831 1:173369991-173370013 AACAAGCAAAGGACTCTCCAAGG + Intergenic
917281099 1:173378837-173378859 AATAAGCAAAGAAATACCCAAGG + Intergenic
917715788 1:177735900-177735922 GTCATTCAAAGAAATCTCCAAGG + Intergenic
918235441 1:182575647-182575669 AGCGAGCAAAGAGATCTTCAGGG - Intronic
918345629 1:183604848-183604870 AATAAGCTGAGAAATCTCTACGG + Intergenic
918442726 1:184584104-184584126 AACAAGCAAACAAACCAACAGGG - Intronic
918865226 1:189888437-189888459 AACTAGCTAAGAAATCTTTAAGG - Intergenic
919332995 1:196194842-196194864 AAGAAGAAAAAAAATCACCAAGG + Intergenic
919558599 1:199092399-199092421 AACAAGCAAAGAAACCTCCAAGG + Intergenic
920257729 1:204667331-204667353 GACAAGCAAAGAAATTTACAGGG - Intronic
920369464 1:205468980-205469002 ATCAAGCACAGGGATCTCCATGG + Intergenic
920448673 1:206040231-206040253 GAAAAGAAAAGAAATCTCCAAGG + Intronic
920519606 1:206613429-206613451 AACAAACAAAAAAACCTCGAGGG + Intergenic
920759257 1:208766125-208766147 AACAAACAAAAAAAGCTGCAAGG + Intergenic
922111386 1:222560060-222560082 AACAAGGAAAGACCCCTCCAAGG + Intronic
922489510 1:226004658-226004680 GAAAAGAAAAGAAATCTCAAAGG - Intergenic
923502245 1:234575470-234575492 AAAAAGAAAAGAAAACACCATGG - Intergenic
923509129 1:234634284-234634306 TACAAGCCAAGAAATGTCAAGGG + Intergenic
924137030 1:240979003-240979025 AACAAGCAACGAAATGGCAATGG + Intronic
924478179 1:244400417-244400439 AACAAACAAAAAAAGCTACAGGG - Intergenic
924513997 1:244751226-244751248 AACAAACAAAGAAAACGACAAGG + Intergenic
1063414747 10:5864304-5864326 AACAAGCAAAGAAATCTCCAAGG + Intronic
1063859137 10:10289578-10289600 AACAAGCAAGGAAATCTCCAAGG - Intergenic
1064280801 10:13949847-13949869 AAGACGCTGAGAAATCTCCATGG - Intronic
1064603615 10:17016704-17016726 AATAAGCAAAGAAATCTCCAAGG - Intronic
1064717650 10:18193503-18193525 TATTAGAAAAGAAATCTCCAAGG + Intronic
1065082361 10:22140937-22140959 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1065154194 10:22852919-22852941 AACAAACAAAAAAAGCTCAAAGG + Intergenic
1065386266 10:25136454-25136476 AACAAGCAAACAAATACACATGG - Intergenic
1067323856 10:45247849-45247871 AACAAGCAAAGCCATCACAATGG + Intergenic
1067997322 10:51288369-51288391 AAAATGTAAAGAAATTTCCAAGG + Intronic
1069051690 10:63802116-63802138 ATCAAGCCAAGAAACCTGCAAGG + Intergenic
1069533424 10:69235463-69235485 AACAAACAAAAAAGTTTCCAGGG + Intronic
1069979790 10:72244309-72244331 AACACGCAAAGAATTATCGAAGG + Intergenic
1070165798 10:73896892-73896914 AACAAACAAAGAAAACTCCCAGG + Intergenic
1070484408 10:76915599-76915621 AACAAACAAACAAATCTCAGCGG - Intronic
1071617468 10:87088501-87088523 AAAGAGCAAAGAAATAACCAAGG - Intronic
1072478635 10:95788030-95788052 AACTTGCAAAGGTATCTCCAAGG - Intronic
1073159846 10:101383049-101383071 AAAAAAAAAAAAAATCTCCAGGG - Intronic
1073493173 10:103868785-103868807 AAAAAGAAAAAAAATCTGCATGG + Intergenic
1074085840 10:110208581-110208603 AACAACCAAACAGCTCTCCACGG + Intronic
1074596165 10:114869008-114869030 GACAAGCAAAAGCATCTCCAAGG + Intronic
1075146288 10:119885655-119885677 AACAAGCAAAGAAATCTCCAAGG + Intronic
1075400608 10:122159002-122159024 AACAAGGCAAGAAAGCGCCAAGG + Intronic
1076627907 10:131833241-131833263 AACAAGAAAAGCAGTCCCCAAGG - Intergenic
1077972809 11:7213011-7213033 AATAAGCAAAGCAAAGTCCATGG + Intergenic
1079061503 11:17252684-17252706 AAAAAGAAAAGAAATCTTCAAGG + Intronic
1079408767 11:20167151-20167173 AAAGAGAGAAGAAATCTCCAGGG + Intergenic
1079744685 11:24109794-24109816 GACAAGCAAATAAATGTCCTTGG + Intergenic
1080799753 11:35599253-35599275 GAGAAGCAAAAAAATTTCCAAGG - Intergenic
1081186573 11:40050156-40050178 AACAAGCAAACAAAACTCTTTGG - Intergenic
1082172299 11:49020116-49020138 AACTCACAAAGAAAACTCCAGGG - Intergenic
1083224021 11:61273456-61273478 AACTGACAAAGAAATCTCCAAGG + Intronic
1083537658 11:63485912-63485934 ATCAAGCAAATAAATCAGCAAGG + Intronic
1085484274 11:76848730-76848752 AAAAGGAAAAGAAATATCCAAGG + Intergenic
1085900400 11:80692546-80692568 AACACACAAACAAATCTGCAAGG + Intergenic
1085985667 11:81784778-81784800 AAAAAGCAAAGGAATTTCCTTGG - Intergenic
1086119684 11:83293164-83293186 AAGAAGCAAAGAATTGTCCTTGG - Intergenic
1086336749 11:85808952-85808974 GACAAGCAAACATATTTCCAGGG + Intronic
1086594014 11:88549509-88549531 AACAACAAAAGAAATGTCCAAGG + Intronic
1088592023 11:111411770-111411792 AACAAAAAAAGTAAGCTCCATGG + Intronic
1088722937 11:112610566-112610588 AATAAGCAAAGAAGCCTTCAAGG + Intergenic
1088947821 11:114533095-114533117 AACAAACAAACAAAAATCCAAGG + Intronic
1089948577 11:122504120-122504142 ATCATGGAAAGAAATCCCCAAGG - Intergenic
1091869871 12:3880434-3880456 GACAAGAAAAAAAATGTCCATGG - Intergenic
1092594413 12:9985823-9985845 AATAAGCAAATAAATTTTCATGG + Intronic
1092885558 12:12921724-12921746 AACAATCTAAGAACTCTCCATGG - Intergenic
1093111656 12:15159829-15159851 AACAAACAAAAAAATCTTAATGG + Intronic
1093203489 12:16218838-16218860 AACAAGCAAACAAAAAACCAGGG - Intronic
1094055024 12:26260157-26260179 AACAAAAAAAGAAAACTTCAGGG + Intronic
1094686492 12:32721622-32721644 ATCAAGCAAGGAATTCTCCAGGG + Intronic
1095543386 12:43337912-43337934 AACAAACAAATAAATCTTCTAGG + Intergenic
1095587287 12:43863273-43863295 AACAAACAAACAAAACTTCAAGG + Intronic
1096310982 12:50520543-50520565 AACAAGCAAAGAACTATGGAAGG - Intronic
1096827463 12:54290866-54290888 AACAAACAAAAAAATCTTTAAGG + Intergenic
1097093854 12:56529588-56529610 AACAACAAAACAAATCTCTAGGG + Intronic
1097550252 12:61059165-61059187 AACAAACAAAAAAAACCCCAGGG - Intergenic
1098387872 12:69938189-69938211 AACTATCACAGAAATCCCCAAGG + Intronic
1099368555 12:81800729-81800751 CACAAGCATATAAATTTCCAGGG + Intergenic
1099376216 12:81898563-81898585 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1100042128 12:90332657-90332679 AACAAGCAAAAACAACTCCTAGG - Intergenic
1100092109 12:90984775-90984797 AACAAGCAAAGAAATCTCCAGGG + Intronic
1100209752 12:92388717-92388739 AACAAGAAAAGAAATCTCCAAGG + Intergenic
1100530268 12:95455872-95455894 AACAACCAAAGAAATCTCTAAGG - Intergenic
1102408079 12:112691333-112691355 AAAAAGCCCAGAAATCTCTAGGG + Intronic
1102811223 12:115825573-115825595 AAAAAGCATATAAATCTCCTGGG + Intergenic
1102979371 12:117229282-117229304 ACCAAGCACAGGAGTCTCCAGGG + Intronic
1103315432 12:120051023-120051045 GAAAAGAAAAAAAATCTCCAGGG - Intronic
1103998590 12:124845705-124845727 AAAAAAAAAAGAAATGTCCAGGG + Intronic
1104202782 12:126608055-126608077 AACAAGCAAATAAAATGCCAAGG + Intergenic
1104202786 12:126608112-126608134 AACAAGCAAACAAAATGCCAAGG + Intergenic
1104306143 12:127612384-127612406 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1104767063 12:131336984-131337006 AACAAGCAAACAAATCTCCAAGG + Intergenic
1105254153 13:18729565-18729587 AATAAGCAAAATAATCTACAGGG + Intergenic
1106527819 13:30558733-30558755 AATAAGGAAAGAAAGCTCCTGGG - Intronic
1106735110 13:32581077-32581099 TAAAGGCATAGAAATCTCCAAGG - Intergenic
1107218087 13:37946193-37946215 GGCAAGGAAAGAAATCTACAAGG - Intergenic
1107871592 13:44751401-44751423 AACAAACAAACAAAACACCAGGG + Intergenic
1108816652 13:54300718-54300740 AAGTAGCAAAGAATTCTCTATGG - Intergenic
1109172111 13:59109295-59109317 ACAAATCAAAGAAATCTCCAAGG - Intergenic
1109424267 13:62150926-62150948 AACAAGCAAAGAAATATCCAAGG + Intergenic
1109489426 13:63076651-63076673 AAGAAGCAGTGAAATCCCCAGGG - Intergenic
1110582745 13:77150875-77150897 ATCAAGCAAAGAAACCTCAAAGG - Exonic
1110888062 13:80663728-80663750 AAAAAGGAGAGAAATCACCAAGG - Intergenic
1111090390 13:83438804-83438826 CACAAGCCAAGAAATGTACATGG - Intergenic
1111372496 13:87335645-87335667 AGCAAGCAAGGAAATCTCCAAGG + Intergenic
1111580455 13:90215884-90215906 AACAAGTACAGTCATCTCCACGG + Intergenic
1111795789 13:92918112-92918134 AACAAGGAAAGAAGTTTCAAAGG + Intergenic
1112965173 13:105181837-105181859 AACAAACAAAAAACCCTCCAGGG - Intergenic
1113221739 13:108112202-108112224 CAAAAGCAAAGAAATCTCCTTGG - Intergenic
1113551541 13:111196642-111196664 AATAAGCAAAGAAATCTCCAAGG - Intronic
1114471183 14:22963737-22963759 AACAAACAAACAAAAATCCAAGG - Intronic
1114999682 14:28406585-28406607 GGCACCCAAAGAAATCTCCATGG - Intergenic
1116053344 14:39832313-39832335 TACAAGCAAAGAAGTGGCCATGG - Intergenic
1116126125 14:40787149-40787171 AAAAAGCAATGTAATCTTCAAGG - Intergenic
1116370016 14:44118310-44118332 AACAAGAAAAAAAAACCCCAAGG - Intergenic
1116771807 14:49134821-49134843 AAGAAAGAAAGAAATGTCCAAGG + Intergenic
1117021511 14:51575610-51575632 AAGAAGAAAAAAAATCTCTAAGG - Intronic
1117426759 14:55607603-55607625 AACCAGGAGAGAAATATCCATGG - Intronic
1117921178 14:60726359-60726381 AACAAGCAAACAAAAATTCAAGG - Intergenic
1120384550 14:83827700-83827722 AAAATGCAAAGAAATCCCCTTGG - Intergenic
1121071424 14:91025666-91025688 AAAAAGCAAACAAATCGTCAAGG + Intronic
1121983585 14:98476979-98477001 AAAACGAAAAGAAAGCTCCATGG + Intergenic
1122332151 14:100928102-100928124 AAAAATAAAAGAAATCTACATGG + Intergenic
1123434420 15:20244737-20244759 AAAAAGAAAAGAGAACTCCAGGG + Intergenic
1124707054 15:31974938-31974960 AACAAGAGAAGAAATCTCACAGG + Intergenic
1125227534 15:37411834-37411856 AACAAGAAAAGAAAATTTCAGGG + Intergenic
1126033493 15:44523635-44523657 AACAAACAAACAAATCTTCTTGG + Intronic
1126072108 15:44874288-44874310 AACAAGCAAAGAAATCTCCAAGG - Intergenic
1126086082 15:45012381-45012403 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1126270218 15:46807596-46807618 CAGAAGCAAAGAAATTTCCATGG - Intergenic
1126484309 15:49162539-49162561 AAAAAGCAAAGAATTATTCAAGG - Intronic
1126719294 15:51559729-51559751 AAAAAGCAAAAAAAACTACACGG + Intronic
1126822308 15:52516448-52516470 GAAAAGCAAAGAAACTTCCAAGG + Intronic
1126955320 15:53927284-53927306 AGCAAACAAAGTGATCTCCATGG - Intergenic
1127999101 15:64174335-64174357 AACTAGCAAAGATAAATCCAGGG - Intronic
1130232288 15:82106187-82106209 AGCAATCAAAGAAAACACCAAGG + Intergenic
1130673698 15:85934369-85934391 ATCAAGCAAATAAATTTCCAGGG - Intergenic
1131247930 15:90812004-90812026 AACAGGCAAACAAATATCTAAGG - Intronic
1131318523 15:91364036-91364058 ACAAAGCAAAGAAAACTTCAAGG + Intergenic
1131411168 15:92209426-92209448 AAGAAGCAAAGAAATCTCCAAGG + Intergenic
1133063548 16:3190425-3190447 AAGAATCAAAGAAATTTACAAGG + Intergenic
1133129922 16:3670739-3670761 AAAAAAGAAAAAAATCTCCATGG + Intronic
1133428087 16:5710774-5710796 AACAAGCCCAGAAAACGCCAGGG - Intergenic
1133487277 16:6232571-6232593 AACAAGAAAGTCAATCTCCAAGG - Intronic
1134185941 16:12085081-12085103 AAAAAAAAAAGAAATCCCCAGGG + Intronic
1134623042 16:15704148-15704170 ATTTAGCAAAGAAATCTTCATGG + Intronic
1135230168 16:20698855-20698877 AAGAAGCAAAGAAAACACCCTGG - Intronic
1135515562 16:23130177-23130199 ACCAAGCTAAGAAATTTACATGG + Intronic
1135545941 16:23366732-23366754 AACAAACAAACAAAACTCCTGGG + Intronic
1135610724 16:23864713-23864735 AACAAAAAAAGAAATCTCAGAGG - Intronic
1136007333 16:27340082-27340104 AACAAACAAATAAATGGCCAGGG + Intronic
1136850194 16:33606366-33606388 AAAAAGAAAAGAGAACTCCAGGG - Intergenic
1137987274 16:53119853-53119875 AACAAGTCAAGAAATGTCCAGGG + Intronic
1138011124 16:53381196-53381218 AATAAGCAAAGAAAATTTCATGG - Intergenic
1138140823 16:54567129-54567151 AACAACCAAAAAAATCTAAACGG - Intergenic
1140432281 16:74914520-74914542 ATCAAGAGAAGAAATGTCCAAGG - Intronic
1140776320 16:78251690-78251712 AACAAGCAAGGAAGTGGCCAAGG - Intronic
1141485900 16:84340190-84340212 GACATGCAAAGAAATATACAGGG + Intergenic
1141970112 16:87475738-87475760 AACAATCAAACAAAGCTTCAGGG + Intronic
1203111807 16_KI270728v1_random:1454819-1454841 AAAAAGAAAAGAGAACTCCAGGG - Intergenic
1142787654 17:2236766-2236788 AAGTAGCAAAGAAATGTCCTAGG - Intronic
1143311478 17:5994334-5994356 CACAAGAAAAGAAAACTACAGGG - Intronic
1143415031 17:6740886-6740908 AAGAAGCAAAGATGTCTCCAAGG - Intergenic
1144044784 17:11445725-11445747 AACAAACAAGGAAAGCTCTAAGG + Intronic
1144277230 17:13683878-13683900 AAAAAGCTTAGAAAACTCCAAGG - Intergenic
1144327929 17:14199629-14199651 TACTAGCAAAGAATTCTTCAAGG + Intronic
1145804065 17:27713937-27713959 AACAAGCAAAGAAATCTCTAAGG + Intergenic
1145893647 17:28437598-28437620 AACAAGCAAACACAACTACAAGG + Intergenic
1147034105 17:37667265-37667287 AACAAACAAATATACCTCCATGG - Intergenic
1147744745 17:42688232-42688254 AACGAGTAACCAAATCTCCAGGG - Intronic
1148221999 17:45869664-45869686 AACAAGCAAAAACATCTGCCTGG + Intergenic
1148885619 17:50770172-50770194 TAGAAGCAATGACATCTCCATGG - Intergenic
1149073857 17:52575297-52575319 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1149266471 17:54932790-54932812 TATAAGCAAAAAAATATCCAAGG + Intronic
1150518120 17:65836733-65836755 AATCAGCAAAGAAATATTCAAGG + Intronic
1150921200 17:69485394-69485416 AACAGGCAAACAACTCTGCAAGG - Intronic
1150976832 17:70097002-70097024 TACAATCAAAGAAATCTCCATGG + Intronic
1151123691 17:71821692-71821714 AAGAAGCAAATAAATCTCCTGGG - Intergenic
1153454513 18:5265363-5265385 AACAAAAAAAGAAAACTTCAGGG + Intergenic
1153774981 18:8444832-8444854 AACAAGCAAATAAATATGCAGGG - Intergenic
1153927280 18:9844987-9845009 AACAATTAAAAAAATCTCCTCGG - Intronic
1154015726 18:10615291-10615313 GAAAAGCAAAGAAACCTGCATGG + Intergenic
1154189785 18:12220352-12220374 GAAAAGCAAAGAAACCTGCATGG - Intergenic
1155024965 18:21933114-21933136 ATAAAGCAAAGAAATATACATGG + Intergenic
1155070162 18:22307909-22307931 AACAAACAAAAAACTCTCCAAGG - Intergenic
1155131955 18:22944754-22944776 AACATCCAAAAAATTCTCCAGGG + Intronic
1155170279 18:23262026-23262048 AACAGGCATACAAATCACCAAGG - Intronic
1156279322 18:35619442-35619464 AAGAAGAAAAAAAATCTCAAAGG - Intronic
1156834800 18:41539748-41539770 AAAAAGTACAGAAATTTCCATGG + Intergenic
1156929394 18:42623072-42623094 AATAAGCAAAGAAAGGTACATGG - Intergenic
1157282120 18:46353009-46353031 AATAGGCAAAGACATCCCCAAGG + Intronic
1157668109 18:49505255-49505277 AACAAGAAAAGAAATCAAGATGG + Intergenic
1157840353 18:50951890-50951912 AAAAAAAAAAAAAATCTCCAGGG + Exonic
1158204266 18:54974044-54974066 AACACCCAAAGAAATATCTAGGG - Intergenic
1158217594 18:55116257-55116279 ACCAAGTAAGGCAATCTCCAAGG + Intergenic
1158522527 18:58183575-58183597 AACATGAAAAGCTATCTCCAAGG - Intronic
1158868599 18:61662137-61662159 AACCAGAAAAGATATCTCAAAGG - Intergenic
1159223314 18:65495191-65495213 AGCAAACAAAGAAATGACCATGG - Intergenic
1159710730 18:71755815-71755837 AAAAAGGAAAGAAAACTACAGGG + Intronic
1159801848 18:72909809-72909831 AACAATCACAGACATCTACACGG + Intergenic
1160166904 18:76521803-76521825 AATAACAAAAGAAATCTCCCGGG - Intergenic
1160625866 18:80204609-80204631 AAAAAAAAAAAAAATCTCCAGGG + Intronic
1161174100 19:2829913-2829935 GAAAAGAAAAGAAATGTCCAGGG - Intronic
1161434371 19:4253818-4253840 AAAAAAAAAAAAAATCTCCAAGG - Intronic
1161598278 19:5163803-5163825 AACAAGCAAAGAAATCTCCAAGG - Intronic
1162237527 19:9320863-9320885 AACAAGCAAAGAAATCTCCAAGG - Intergenic
1162920618 19:13900124-13900146 AAAAAGCAAAAAAATATCAATGG + Intronic
1163854773 19:19692708-19692730 AAAAAGCCATGATATCTCCAAGG + Intergenic
1164411073 19:28005825-28005847 AACCAGAAAAAAAATCACCATGG - Intergenic
1165030653 19:32995859-32995881 AAAAAGAAAAGAGAACTCCAGGG + Intronic
1165362158 19:35343510-35343532 AAAAAGCAAAGAAAATTCCCAGG - Intronic
1165753439 19:38276317-38276339 AACAAGCAAAAATAACTCCTAGG - Intronic
1166891903 19:45999226-45999248 ACCAAGCAATGAAATCTCTACGG - Intronic
1167692239 19:50992937-50992959 AAAAAGGAAAAAAATCTCCTTGG + Intergenic
925441984 2:3895893-3895915 AACAAAAAAAGAAAACTTCAGGG - Intergenic
926437781 2:12854981-12855003 CCCAAGCAAAGAAAACTCTATGG + Intergenic
926793795 2:16602019-16602041 ACCAAAGAAAGAAATCTCCTAGG - Intronic
926984941 2:18612330-18612352 TACAAGCCAAGAAATGTCGAAGG - Intergenic
927089533 2:19699998-19700020 AACAAGTAAATGAATCTGCAGGG - Intergenic
927748801 2:25647348-25647370 ATCAAGCAATCAAATCACCAAGG + Intronic
928263240 2:29786764-29786786 AACAAACAAAAAAAACTCCCAGG - Intronic
928469797 2:31562831-31562853 AACAAATAAATAAATGTCCAGGG + Intronic
928615992 2:33040080-33040102 ACCAAGGAATGAAATCTCTATGG - Intronic
929712178 2:44276564-44276586 AACAAGTAAAGAATTAACCAGGG + Intronic
929751235 2:44715723-44715745 AACAAAAAAAAATATCTCCAGGG - Intronic
931464904 2:62477399-62477421 AACAAACAAAAAAATCTCTCAGG + Intergenic
931694671 2:64862782-64862804 AACAACCACAAAAATCTCAATGG - Intergenic
931844718 2:66191495-66191517 AACATGCACACAAATCTCCTGGG - Intergenic
932647634 2:73521228-73521250 AACAACCTAAAAAATCTCTATGG + Intronic
932997016 2:76867442-76867464 AAACAGCAAAGATATTTCCATGG - Intronic
933342104 2:81037376-81037398 AACAAGCAAAGAAATCTCCAAGG + Intergenic
933906465 2:86898686-86898708 AAGAAGAAAAGAAATTGCCAAGG - Intergenic
934219331 2:90067415-90067437 ATCACGCAAAGAAATCCACAAGG - Intergenic
934489118 2:94746502-94746524 AATAAGCAAAATAATCTACAGGG + Intergenic
934575078 2:95395045-95395067 AACAAGTAAAGAGAACTCTAAGG - Intergenic
934813331 2:97303383-97303405 AACTTTCAAAGACATCTCCAGGG + Intergenic
934824364 2:97405097-97405119 AACTTTCAAAGACATCTCCAGGG - Intergenic
934867072 2:97823218-97823240 AACAAGCAAAGAAATCTCCAAGG + Intronic
935125829 2:100221969-100221991 AACAAGCAGAGAGAGCTGCAAGG - Intergenic
935547521 2:104416730-104416752 AACAAGCAAATAAAGCTCCGAGG - Intergenic
935926171 2:108071906-108071928 AACCTGCAAAGAAATATTCATGG - Intergenic
936449011 2:112619421-112619443 AAGGGGCAAAGAAAACTCCAGGG - Intergenic
936802093 2:116282590-116282612 AATGAGCAAAGAAATCTCCAAGG + Intergenic
937012028 2:118571615-118571637 AACAAGAATAGAAAATTCCAGGG - Intergenic
938339487 2:130526219-130526241 AACAAGCAAACAAACATCCGTGG + Intronic
938350352 2:130594533-130594555 AACAAGCAAACAAACATCCGTGG - Intronic
938823496 2:134981863-134981885 AAAAAGAAAAGAAATCTCTGAGG - Intronic
939427811 2:142062349-142062371 ACCAAGGAAATAAATCTGCAAGG + Intronic
939581940 2:143960946-143960968 TAAAAGCTGAGAAATCTCCAAGG + Intronic
939650958 2:144761366-144761388 ATCAAACAAAGGAATCTACAAGG + Intergenic
939851807 2:147313503-147313525 AACAAGCAAAGAAATCTTTAAGG + Intergenic
940273161 2:151913604-151913626 AAAATGCAAAAAAATCGCCAGGG + Intronic
940335805 2:152526051-152526073 AAAGAGCAAATATATCTCCATGG + Intronic
940367555 2:152865074-152865096 AATTAGCAAACAAATCTTCAGGG + Intergenic
940506738 2:154565141-154565163 TACAAGTACAGAAATCTCCTAGG - Intergenic
940563574 2:155332653-155332675 AACAATAAAAGAAAACTTCAGGG - Intergenic
940693499 2:156949695-156949717 AACAAGCATATAAATGTGCATGG + Intergenic
941335401 2:164237850-164237872 AACAAGGAAAGAACTCTACTGGG - Intergenic
942243951 2:173990353-173990375 AACAGGCAGAGGAATCTCCTGGG - Intergenic
942577243 2:177376974-177376996 AACAATAAAAGCAATCTCCGAGG + Intronic
943094363 2:183410886-183410908 AAAATCCAAAGTAATCTCCAGGG + Intergenic
943790954 2:191931873-191931895 AACGAGCAAAGAAAGCTCCAGGG - Intergenic
944120272 2:196233266-196233288 AATAAGCACAGATGTCTCCAGGG + Intronic
944212105 2:197217245-197217267 AAGAAGCAAATAAATATCCAGGG + Intronic
944341059 2:198600180-198600202 AACAACCAAAAAAAACTCCCAGG - Intergenic
945187477 2:207154397-207154419 AACAAGCCAAGCAAATTCCAAGG + Intronic
945299505 2:208202792-208202814 AACAAACACAAAAATCTTCATGG - Intergenic
946763969 2:223022922-223022944 TACAAGCCAAGAATTCACCAAGG - Intergenic
946831102 2:223728877-223728899 AACCAGCAAACATATTTCCATGG + Intergenic
947202357 2:227625789-227625811 GACAGACAAAGAAATATCCATGG - Intronic
947579011 2:231300226-231300248 AACCAGCAAGTAAATGTCCACGG - Intronic
947672544 2:231947546-231947568 AACAAACAAAAAAATTTTCATGG + Intergenic
947798693 2:232912265-232912287 AACAAGAAAAAAAAACTGCATGG - Intronic
1168870353 20:1122261-1122283 AAAAAGAAAAGAAAACTCTAAGG - Intronic
1169496272 20:6118707-6118729 AACAAAGAAAGAAATCTTCAGGG - Intronic
1169655269 20:7915645-7915667 AAAAAGATGAGAAATCTCCAAGG + Intronic
1169982852 20:11406009-11406031 AACATGAAAAGAAATATCCATGG - Intergenic
1170427956 20:16254380-16254402 AACAAGAAAAGAAATTTCAGTGG - Intergenic
1170462721 20:16593187-16593209 ACAAAGCAAAGAAAGTTCCAGGG + Intergenic
1171432160 20:25089890-25089912 TAGAAGCAGCGAAATCTCCACGG + Intergenic
1172078236 20:32316219-32316241 AACAAGCAACTTACTCTCCATGG - Exonic
1172340598 20:34154550-34154572 AACAATCAAAGAAATCTCCCAGG + Intergenic
1172790158 20:37498297-37498319 AAGAAGCAATTAAATGTCCATGG + Intronic
1173360010 20:42334943-42334965 AAAAAGCATAGAAATCCACAAGG + Intronic
1173395706 20:42677698-42677720 AACAAACAAAAAAAACCCCAAGG + Intronic
1173586798 20:44188262-44188284 AAAGAACAAATAAATCTCCATGG + Intergenic
1173869369 20:46331898-46331920 AACAAACAAAGAAAACTTCCTGG - Intergenic
1174083041 20:47984255-47984277 AACATGCAAAGAAGCATCCAGGG + Intergenic
1174690745 20:52502090-52502112 AATATCCAAAGATATCTCCATGG + Intergenic
1174720369 20:52805421-52805443 AACAAACAAATAAATCACCCTGG - Intergenic
1174915556 20:54649592-54649614 CGCAAGCAAAGAAATGTACACGG - Intronic
1176699839 21:10032489-10032511 AACAAACTAAGAAGTTTCCAGGG - Intergenic
1176840168 21:13834608-13834630 AATAAGCAAAATAATCTACAGGG + Intergenic
1177135011 21:17298909-17298931 AACAAGCAAAGAAATATCCATGG + Intergenic
1177546915 21:22570133-22570155 AACAAACAAATAGTTCTCCAAGG + Intergenic
1177629554 21:23708965-23708987 AACAAGGAAAGAAATATCAAAGG + Intergenic
1177659715 21:24066832-24066854 AACAAAAAAAGGAATCTCTAGGG - Intergenic
1178245275 21:30944661-30944683 AACAACCATGGAAATCTCAATGG - Intergenic
1179005148 21:37507459-37507481 AACAAGCAAAGAGGTCTTCAGGG - Intronic
1179496605 21:41775816-41775838 AACTAGCAAACAATTCTGCAGGG + Intergenic
1183806737 22:40217998-40218020 AATAAGCACAGAACCCTCCAAGG + Intronic
1184196212 22:42930641-42930663 AAAAAGCAAAAATACCTCCATGG + Intronic
1184928593 22:47662665-47662687 AAGAAGCAAACAACTTTCCAGGG - Intergenic
949325729 3:2861788-2861810 AATAAGGAAAGAAAGATCCAAGG - Intronic
949449021 3:4165400-4165422 AATAAGTAAAGAAATCTCCAAGG - Intronic
950101299 3:10358554-10358576 ATCAAGGAAGGAAATCCCCATGG + Intronic
950225766 3:11233267-11233289 AACAAACAAACAGAACTCCAGGG - Intronic
951220655 3:20065720-20065742 AACAAGTAAGGAAAACTCAAGGG + Intronic
952498592 3:33937689-33937711 AACCAGCATAGAATTTTCCAGGG + Intergenic
952582273 3:34848478-34848500 AACAGGCAAAGTATTATCCATGG - Intergenic
952657566 3:35804163-35804185 TAAAAGAAAAAAAATCTCCATGG - Intergenic
954781244 3:53062917-53062939 AACAAGCAAAAAAATCTAAAGGG - Intronic
955130553 3:56162330-56162352 CACAAGAAAAGAAAACTACAGGG - Intronic
955633632 3:61001949-61001971 AACAAACAAAGAAATGTAGAGGG - Intronic
955691800 3:61598395-61598417 GATAAGAAAAGGAATCTCCAGGG - Intronic
956015899 3:64882206-64882228 AACTAGAAAGGAACTCTCCATGG - Intergenic
956661011 3:71597438-71597460 AACAAACATATAATTCTCCAAGG + Intergenic
957503558 3:81090424-81090446 AACAAGAAAAGGAAGCTACAAGG + Intergenic
957612693 3:82489063-82489085 AACAAGCAAACAGATCACCATGG - Intergenic
957690568 3:83560947-83560969 AGCAAACAAAGACTTCTCCATGG - Intergenic
957981494 3:87517101-87517123 CACAAGCCCAGAAATGTCCAAGG - Intergenic
958070367 3:88602933-88602955 AAGAAGGAAAGAAATATCCAAGG + Intergenic
958765077 3:98358136-98358158 CACCAGAAAAGAAGTCTCCAGGG - Intergenic
960063633 3:113348647-113348669 AATAAGCAAAGAAATCTCCAAGG + Intronic
960154864 3:114289789-114289811 AAGAAGGAAAGAAGTGTCCAGGG + Intronic
960228056 3:115190505-115190527 AACAAGAAAACAATTGTCCATGG - Intergenic
960542481 3:118876822-118876844 AACAAGCTGCCAAATCTCCAAGG + Intergenic
960782631 3:121336529-121336551 AACAAACAAAAAAATCCACAAGG + Intronic
960807301 3:121596537-121596559 AACATGCAAAGGAATCACCCGGG - Intronic
961168862 3:124781582-124781604 AGCAACTAAATAAATCTCCAAGG + Intronic
961208334 3:125105522-125105544 ACCAAGCAAAGAAAAAACCAAGG + Intronic
961261607 3:125606486-125606508 AACAAGCAAAGAAATCTCTAAGG + Intergenic
962160917 3:132999432-132999454 AAAAAACAAAAAACTCTCCATGG - Intergenic
962261754 3:133914614-133914636 AACAAGCATTGTAGTCTCCATGG - Intergenic
963276273 3:143333332-143333354 AGCAAGCAAATAATGCTCCATGG + Intronic
963471287 3:145745304-145745326 AAGAAGGAAGAAAATCTCCAGGG + Intergenic
963666071 3:148188172-148188194 AAGAAGCATAGAATTCTCCAAGG - Intergenic
963861882 3:150320134-150320156 GTCAGGCAAAGAATTCTCCAAGG - Intergenic
964109868 3:153077026-153077048 AACAAACAAACAAATGTCCTGGG + Intergenic
964361425 3:155901451-155901473 AACAAGTAAAAAAATATTCATGG - Intronic
965088083 3:164125433-164125455 AATAAGCAAATAAATGACCATGG - Intergenic
965099802 3:164280819-164280841 AACAAGCAAATAAATAAGCAAGG - Intergenic
966575881 3:181502356-181502378 AACAAACAAACAAACCTACAGGG - Intergenic
966886980 3:184382279-184382301 AACATGGAAAGGAACCTCCAGGG - Intronic
967354077 3:188548330-188548352 ACCAAGAAAAGGAATCACCACGG - Intronic
967631285 3:191745054-191745076 ATCTAGCCAAGAAAACTCCAGGG - Intergenic
968468875 4:767539-767561 TTCAAGAAAAAAAATCTCCAAGG - Exonic
969553644 4:7891212-7891234 AACTGGCAAAGGAATCTGCAGGG + Intronic
969844781 4:9911840-9911862 AAGAAGCAATCACATCTCCATGG - Intronic
970117421 4:12712675-12712697 AACAAACAAAACAATCTACAAGG + Intergenic
970241958 4:14018773-14018795 AACTAGAAAAGAAATCTCTCAGG + Intergenic
971310907 4:25525112-25525134 AACAAACAAACAAAACACCATGG - Intergenic
971318793 4:25588735-25588757 AACAAACAAACAAAACTACAAGG - Intergenic
971578413 4:28305141-28305163 AACAAGCAAAGAAATCTCCAAGG + Intergenic
971656903 4:29359631-29359653 AACAAGCAAACCAATCTTCCTGG - Intergenic
971934166 4:33125994-33126016 AACAATCAATGATATGTCCAAGG - Intergenic
972133365 4:35863068-35863090 AACAAGCAAAGAAATCTCCAAGG - Intergenic
972827472 4:42776886-42776908 AACAAACAAAGAAGTGTCAAGGG + Intergenic
973334382 4:48941644-48941666 AGCAAACAAAGAAATCATCAAGG + Intergenic
973348614 4:49083410-49083432 AAAAAGAAAAGAAATCTACCTGG - Intergenic
973983086 4:56323110-56323132 AAAACTCAAATAAATCTCCAGGG - Intronic
975047935 4:69826966-69826988 AACAAGCAAAGAAATCTCCAAGG + Intronic
975510740 4:75191933-75191955 AGCAAGCAAAGGAAACTGCATGG + Intergenic
975703664 4:77090690-77090712 AACAAGCAAAGAAATAACATGGG - Intergenic
975718209 4:77226219-77226241 AACAGGCAAGGAATTCTACATGG - Intronic
976136344 4:81940764-81940786 AACAAAAAAAGAAAACTACAGGG + Intronic
976754669 4:88485182-88485204 AGCAACAAAAGAAATCTTCAGGG + Intronic
977373278 4:96168378-96168400 TATAGGCAAAGATATCTCCAGGG + Intergenic
977834982 4:101636144-101636166 AACAAGCAAAGAAATCTCCAAGG - Intronic
978757595 4:112320493-112320515 AACAAAAAAAGAAAACTACAGGG - Intronic
979158941 4:117434034-117434056 AAAAAGCAAATTAATCTCAAAGG - Intergenic
979756655 4:124349031-124349053 AGCAATCAAAGAAACCTTCAAGG - Intergenic
980283464 4:130752839-130752861 AACAATCACAGAACTCTTCAAGG - Intergenic
980648377 4:135675912-135675934 AACTATCAAAGCAATCTCCAGGG + Intergenic
981495311 4:145385111-145385133 AACAAACAAAGAGAGCTTCAGGG - Intergenic
981865791 4:149417327-149417349 AACATGCAGATAGATCTCCAGGG - Intergenic
982185636 4:152795259-152795281 AAAAAGCAAAAAAATCCCTATGG - Intronic
983063693 4:163186934-163186956 AACAAGTAAATAAGTCTTCAGGG + Intergenic
983164929 4:164463646-164463668 AACAGGCAATGAAATATCCAAGG + Intergenic
983433416 4:167680555-167680577 CACAAGCAAAGATAACTCCCAGG - Intergenic
983768434 4:171517577-171517599 AACAAGCAAAGAAATATTGAAGG - Intergenic
983817001 4:172143429-172143451 AACAAGGAAGGAAATCTACTAGG - Intronic
983819048 4:172170488-172170510 AACCACCAAAGAAACTTCCAGGG - Intronic
983920287 4:173336616-173336638 AACAAGCAAAGCTCTCTCAAAGG - Intergenic
985211391 4:187599309-187599331 AACTATAAAAGAAATATCCATGG + Intergenic
986088880 5:4482226-4482248 AACAATCACAGAACTCACCAGGG - Intergenic
986820398 5:11460563-11460585 AACAAGCAGAGAAATGCACAGGG - Intronic
987008515 5:13736215-13736237 GACAATCAAAGAAATTTCAAAGG + Intronic
987276798 5:16371596-16371618 AGAAGGCAAAGAAAACTCCAAGG - Intergenic
988778771 5:34500364-34500386 AACATGCATAGAAATCCCTAAGG - Intergenic
989336318 5:40320994-40321016 ATCAAGAAAAGGAACCTCCATGG + Intergenic
989550173 5:42726025-42726047 AGCATGCAATGAAGTCTCCATGG - Intergenic
989702365 5:44285423-44285445 TAAAAGCAAAGAAATCTGGAGGG + Intergenic
991051472 5:62277290-62277312 AACAATCAAAGCAATCTTCTAGG + Intergenic
991194879 5:63920992-63921014 CACTGACAAAGAAATCTCCATGG + Intergenic
992230445 5:74658334-74658356 AAAAAGCAAAGCATTCTGCATGG + Intronic
992545710 5:77812143-77812165 AACAAGCAAAGAAATCTCCTAGG + Intronic
993056291 5:82983877-82983899 AAAAAGCAAAGGAATCTAAAAGG - Intergenic
993717962 5:91294314-91294336 AACAAAAAAAGAAATATACATGG + Intergenic
993874967 5:93295749-93295771 AACAAGCAGAAAAATCTCACAGG + Intergenic
994810282 5:104508677-104508699 GTCAAGGAAAGAAATCTCAAAGG + Intergenic
995583486 5:113623673-113623695 AACAAGCAAAGATATCTCCAAGG - Intergenic
996071145 5:119133309-119133331 AACTAGCAAAGAACCATCCATGG - Exonic
997072334 5:130635729-130635751 AATAAGCAAAGAAATCTCCAAGG + Intergenic
997073651 5:130646179-130646201 GACAAGCAAAGAAAACTTTAAGG + Intergenic
997101294 5:130971802-130971824 AACAGGTAAAAGAATCTCCAAGG + Intergenic
998090861 5:139367595-139367617 AACAGGAAAAGAAAACTACATGG - Exonic
999921876 5:156330027-156330049 AAAAAAAAAAAAAATCTCCAAGG + Intronic
1000086694 5:157893876-157893898 AACAAACAAAGAAAACTAAAGGG + Intergenic
1000550868 5:162662541-162662563 AACAAGTAAAGAAATCTTACTGG + Intergenic
1000718015 5:164670890-164670912 ATCAATCAAAGAAACCTGCATGG - Intergenic
1001735736 5:173998042-173998064 AACAAGTATAAAAATCCCCAAGG + Intronic
1002993697 6:2262560-2262582 AAGAAGCAAAGAAAACTCAGTGG - Intergenic
1003673397 6:8180685-8180707 AACAAGCAAACCCATCTTCATGG - Intergenic
1003689457 6:8338234-8338256 AACAGACAAAGAAGTCTGCAAGG - Intergenic
1003805723 6:9724430-9724452 AATAAGCAAAGAAATCTCCAAGG + Intronic
1004054872 6:12125470-12125492 ACCAAGAAAGGAAGTCTCCAGGG + Exonic
1004751846 6:18569643-18569665 AAGAAGCAAAGGATTCTCCAGGG - Intergenic
1005085667 6:22004373-22004395 AAGAAAAAAAGAAATATCCAGGG - Intergenic
1005088397 6:22031141-22031163 GAGAAGCAAAGAAATTTCAAGGG - Intergenic
1005399742 6:25419319-25419341 AATAAAGAAAGAAAACTCCAAGG - Intronic
1005495569 6:26384912-26384934 AACAAACAAAAAAAACTCCAGGG - Intronic
1006221712 6:32497159-32497181 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1006717295 6:36128787-36128809 AACAAGGAAAGAAATTTGCTAGG - Intronic
1006770784 6:36550823-36550845 AACATGCACATAAATCTCCTGGG + Intergenic
1007029958 6:38618546-38618568 AACAGGCAAAGAAATCATCAAGG + Intronic
1007352981 6:41287962-41287984 AACAACCAAAAAAATTTTCAAGG + Intergenic
1007687834 6:43677542-43677564 AACAAGTAAGGATTTCTCCAGGG + Intronic
1008066829 6:47059033-47059055 AACATCCCAAGAAGTCTCCAAGG + Intergenic
1008159255 6:48057371-48057393 AACCAGCAAGGAAATCTGCAGGG - Intronic
1008256973 6:49314467-49314489 AGCACACAAAGAATTCTCCAGGG + Intergenic
1009386011 6:63084664-63084686 AACAAGCAAATAAATCTCCAAGG - Intergenic
1009666426 6:66687047-66687069 AACATTCGAAGAGATCTCCAAGG - Intergenic
1009713729 6:67359577-67359599 AACAATAAAAAAAAACTCCAAGG - Intergenic
1010696472 6:78980478-78980500 AGGAATCAAAGATATCTCCAGGG + Intronic
1010782696 6:79963441-79963463 AAGAAGCAAAGAAAATTCAATGG + Intergenic
1011701680 6:89960902-89960924 AACAACCAAAGAAATACCTAAGG - Intronic
1012915092 6:105161535-105161557 GACAGGCAAAGAGATCCCCAGGG + Exonic
1012964884 6:105662863-105662885 AACAGGAAAAAAAATCTTCACGG + Intergenic
1013320359 6:108981961-108981983 AAAAAGGAAAGAAATCAGCAGGG - Intergenic
1014055237 6:117007057-117007079 AACAAGCATCTAAATCTACAAGG + Intergenic
1015065573 6:129022151-129022173 AAGAAGCAAGCAAATATCCAAGG - Intronic
1015453710 6:133400731-133400753 AACAATTTAAGATATCTCCAAGG - Intronic
1015510642 6:134034939-134034961 AAAAAGCCAAGAATTCCCCATGG - Intronic
1017649691 6:156569500-156569522 AATAAGCAAAGAAATTTTCGTGG - Intergenic
1017748133 6:157465606-157465628 AAAAAAAAAAGAAATCTTCAAGG + Intronic
1018070453 6:160160309-160160331 AAAAAACAAAGAACTCTCAATGG + Intergenic
1018742070 6:166737251-166737273 TAGAAGCAAATAAATCTGCAAGG + Intronic
1019807672 7:3140263-3140285 AACAAGAAATCAAATCTCCGGGG - Intronic
1019952177 7:4382531-4382553 AAAAAGAAAAGAAAAATCCAAGG - Intergenic
1020505912 7:8987447-8987469 AAAAAAAAAAAAAATCTCCAGGG + Intergenic
1020789536 7:12609521-12609543 AACAAACAAAAAAAACCCCAAGG + Intronic
1021013996 7:15509518-15509540 ATCAAGAAAAAAAATTTCCAAGG - Intronic
1021272354 7:18605668-18605690 AACAAACAAACAAAACTCCAGGG - Intronic
1021324375 7:19247337-19247359 AACAAGGAATGGAATCTGCATGG - Intergenic
1022855972 7:34314998-34315020 AACAGGAAAAGGAATTTCCAAGG + Intergenic
1024615271 7:51106485-51106507 AACAAGAAAAGAGTTCTCCCAGG + Intronic
1027953958 7:84856260-84856282 AACAAACAAAAAAACCACCACGG - Intergenic
1028191176 7:87854211-87854233 AAGAAGCCAGGAAATTTCCAGGG - Exonic
1029137924 7:98387900-98387922 AACAACCAAAAAAACCTTCAAGG + Intronic
1029341375 7:99947496-99947518 AAAAAAGAAAGAAATCTTCATGG + Intergenic
1030087032 7:105824946-105824968 AAAAAACAAAAAAACCTCCATGG + Intronic
1030567933 7:111184160-111184182 AAGAATCAAAGAATACTCCAGGG + Intronic
1030897983 7:115085444-115085466 AACAAACAATGAAATTTCCATGG + Intergenic
1030982665 7:116205083-116205105 AAGGAGGAAAGAAATCCCCATGG + Intergenic
1031230899 7:119104523-119104545 AACAAGCAAATAAATCATCCTGG - Intergenic
1031805498 7:126302123-126302145 AAAAAGAAAAGAAAGGTCCAAGG - Intergenic
1031889073 7:127273478-127273500 AAAAAGAAAAGAAATTTCCTGGG - Intergenic
1031936798 7:127743323-127743345 AAGAGGCAAAGAAAGCTTCAAGG - Intronic
1032792996 7:135256119-135256141 AACTAGTAAAGAAAAATCCATGG - Intronic
1033121097 7:138667276-138667298 GACCAGCAAAGAATTTTCCATGG - Intronic
1033153757 7:138938672-138938694 AACAGGCATAGAACTCTACATGG - Intronic
1033512235 7:142070408-142070430 AACAAGCAAACAAATATGCATGG - Intronic
1033515264 7:142099027-142099049 AACAAGCGAACAAATATGCATGG - Intronic
1033945721 7:146715338-146715360 AACAAACAAACAAAACTCTATGG + Intronic
1033951418 7:146789409-146789431 AACATGCAAAGAAATCACAAAGG - Intronic
1034066592 7:148142876-148142898 AACATGCCAAGAGCTCTCCATGG + Intronic
1034849289 7:154479193-154479215 AACAAGTAAGGAAGTCTACAAGG - Intronic
1036518483 8:9468345-9468367 AACAAGAAAAGAAATCTAGGTGG - Intergenic
1037044342 8:14278441-14278463 AACAAGCAAAGTGACCTCAATGG + Intronic
1037109797 8:15152648-15152670 AAAAAGCAAAGATATCTCAAAGG - Intronic
1037219114 8:16495816-16495838 AACAAGGAAAGAAATCTCTCTGG - Intronic
1037290934 8:17348645-17348667 AATAAGCAAAGAGATTCCCAAGG + Intronic
1038430866 8:27498267-27498289 AACAAGCAAAGAAATCTCCAAGG - Intronic
1038860791 8:31387423-31387445 AAGAGGCAAAGAGAACTCCAAGG + Intergenic
1038878639 8:31581198-31581220 AAAAAGAAAAGAAATATTCAGGG - Intergenic
1038894132 8:31762065-31762087 AAAAAGAAAAGAAATTTACAAGG - Intronic
1039233454 8:35474762-35474784 AACAACCAATGAAATCTCAATGG - Intronic
1039275923 8:35934141-35934163 AACAAGCAAGTAAATCTCCAAGG + Intergenic
1039766021 8:40628990-40629012 AAAAAGAAAAGAAAGCTCGAGGG - Intronic
1039937296 8:42056765-42056787 AACAGGCAAAGACACCACCAGGG - Intergenic
1040391167 8:46951762-46951784 AAGAACCAAAGAAAGCCCCAGGG + Intergenic
1040527133 8:48235177-48235199 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1040796880 8:51297142-51297164 AACAAGCAAAGAAATCTCCGAGG - Intergenic
1041001028 8:53453509-53453531 AAAAAGTGAAGAAATCTCAAAGG - Intergenic
1041322117 8:56624106-56624128 AAAAATCAAACAAATATCCATGG - Intergenic
1041419576 8:57651380-57651402 AAAAAGAAAAGAAATCTCAAAGG - Intergenic
1041859353 8:62494467-62494489 AACAAATAAAGAAAACTTCAGGG - Intronic
1042771827 8:72390086-72390108 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1042815343 8:72872471-72872493 AACAACCAAACAACTATCCAGGG - Intronic
1042919532 8:73908148-73908170 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1043008399 8:74849849-74849871 AATAAGAAAAAATATCTCCAGGG - Exonic
1043248993 8:78045664-78045686 AACAAAAAAAGAAAACTACAAGG + Intergenic
1043622835 8:82217874-82217896 AACAAAAAAAGAAATCTTGAAGG - Intergenic
1043667480 8:82834555-82834577 AGCAAGACTAGAAATCTCCACGG + Intergenic
1043686002 8:83086737-83086759 AACAAACAAACAAATCTGGAAGG + Intergenic
1044002443 8:86900151-86900173 AAAAAGAAAAAAAATCTTCAAGG - Intronic
1044005518 8:86932380-86932402 GACAAGCAAAGAAATCTCCAAGG - Intronic
1045669471 8:104532612-104532634 AACAGACAAAGAATTCTCCTCGG + Intronic
1045737291 8:105311189-105311211 AACAAGGATAGAGAGCTCCAGGG + Intronic
1045810829 8:106217688-106217710 GAAAAGAAAAGAAATCTACATGG + Intergenic
1045858467 8:106790692-106790714 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1045986562 8:108256077-108256099 AACCAGCAAGGAAAATTCCAGGG - Intronic
1045994619 8:108348381-108348403 AACAAAAAAAGAAAACTACATGG + Intronic
1046545985 8:115650672-115650694 AACATTCAAAGAAATCTCAGAGG + Intronic
1046611978 8:116435853-116435875 AGCTAGCAGAAAAATCTCCAGGG + Intergenic
1047077895 8:121424530-121424552 AACCAAAAAAGAAATCTCAATGG + Intergenic
1047148170 8:122229718-122229740 AACAAACAAACAAAACTCTAAGG + Intergenic
1047891091 8:129311337-129311359 AACAAGCAGACAACTTTCCATGG - Intergenic
1049424260 8:142531090-142531112 AGCAGGCAAAGAAGTCTCCATGG + Intronic
1051074317 9:13212445-13212467 AATAAACATAAAAATCTCCAAGG + Intronic
1051087550 9:13368060-13368082 AATATGCATAGAAATCACCAGGG - Intergenic
1051529955 9:18090853-18090875 AAAAAGCAAGGAAAACGCCAGGG - Intergenic
1051952227 9:22649788-22649810 AACAACCAAATAAGTTTCCATGG - Intergenic
1052151136 9:25117029-25117051 AAAAATTAAAGAAATCTTCATGG - Intergenic
1052715086 9:32105978-32106000 CAAAAGCAAAAAAGTCTCCAAGG + Intergenic
1053605729 9:39656655-39656677 AACAAACAAAGACATCCGCATGG - Intergenic
1053668667 9:40337842-40337864 AATAAGCAAAATAATCTACAGGG - Intergenic
1053918473 9:42964116-42964138 AATAAGCAAAATAATCTACAGGG - Intergenic
1054247814 9:62685760-62685782 AACAAACAAAGACATCCGCATGG + Intergenic
1054379804 9:64477884-64477906 AATAAGCAAAATAATCTACAGGG - Intergenic
1054515944 9:66038452-66038474 AATAAGCAAAATAATCTACAGGG + Intergenic
1054561928 9:66720285-66720307 AACAAACAAAGACATCCGCATGG + Intergenic
1055114434 9:72591724-72591746 AACAAACAAACAAATAGCCATGG - Intronic
1055929265 9:81542899-81542921 AACAAACAAAAAGATGTCCAAGG - Intergenic
1056028090 9:82521783-82521805 AACATGCATAAAAATCACCAAGG + Intergenic
1056536311 9:87530804-87530826 AACATCCAAAGAAACCCCCAAGG + Intronic
1056912044 9:90710424-90710446 AACAAACAAACAAAAATCCATGG + Intergenic
1057015752 9:91649625-91649647 AACAAGAAAAGAAAGCTACAGGG + Intronic
1057327313 9:94077267-94077289 AACAAGCAATAAATTCTGCAGGG + Intronic
1058579171 9:106436527-106436549 ATCCTGGAAAGAAATCTCCATGG - Intergenic
1059262369 9:112990563-112990585 AACAAAAAAAGAAAACTTCAGGG - Intergenic
1060923196 9:127437160-127437182 ACCATGCAAAGAATGCTCCAGGG - Intronic
1061528081 9:131184911-131184933 AAGAAACAAAGAAATCAACAGGG - Intronic
1062223648 9:135435588-135435610 AAGAAAGAAAGAAAACTCCAAGG + Intergenic
1202784852 9_KI270719v1_random:2548-2570 AACAAACTAAGAAGTTTCCAGGG - Intergenic
1186260436 X:7773080-7773102 AAAAAAAAAAGCAATCTCCATGG - Intergenic
1186358907 X:8818374-8818396 AACAAGGAAAGATTTGTCCAGGG - Intergenic
1186359076 X:8820735-8820757 AACAAGGAAAGATTTGTCCAGGG - Intergenic
1186464174 X:9771602-9771624 GAAAAGCAAAGAAAACTCCCAGG + Intronic
1188259177 X:28002252-28002274 AACAAACAAAAAAATATGCACGG - Intergenic
1189470273 X:41308585-41308607 AAAAAGAAAAAAAAGCTCCAAGG - Intergenic
1191206023 X:57834881-57834903 CCCAAGCAAAGAAATCTCCAAGG - Intergenic
1191999519 X:67133725-67133747 AAGAAGCAAATAAATCATCATGG - Intergenic
1192038589 X:67592598-67592620 AACAAGAAAAGAAATCAATAGGG - Intronic
1192314378 X:70040488-70040510 AACAAACAAACAAACCTCTAAGG - Intergenic
1192482849 X:71500060-71500082 AACAAGAAAAGAGATCTCCAAGG - Intronic
1192762303 X:74105856-74105878 CTAAAGCAAAGAAAGCTCCAAGG + Intergenic
1194126501 X:90024451-90024473 AACAAGAAAAGAAAACTTCAGGG + Intergenic
1194288234 X:92037557-92037579 ACCAAGCAAAGGAATCCCAAAGG - Intronic
1194639444 X:96385649-96385671 CACAAGATAAGAAATCTGCAAGG - Intergenic
1195552471 X:106184883-106184905 AGCAAGCAAAGAAATCTCCAAGG - Intronic
1195766323 X:108299623-108299645 AACTAGCAAAGACATGTACAAGG + Intronic
1195801243 X:108713522-108713544 AAAAAGTAAAGAAATGTCAAAGG - Intergenic
1197145407 X:123166809-123166831 AAGAAGCAAAGACATTTTCAGGG - Intergenic
1198275153 X:135093112-135093134 AAAAAGAAAAGAAAAATCCAGGG - Intergenic
1198412913 X:136390031-136390053 AACAAACAAACAAATTTCTAAGG - Intronic
1198697490 X:139357860-139357882 AACATGCAAAGAAGGCACCAGGG + Intergenic
1199504589 X:148547386-148547408 AACAAACAAAAGAATATCCAGGG + Intronic
1199779769 X:151047625-151047647 AATAAACAAATAAATCACCAAGG + Intergenic
1199930303 X:152511568-152511590 AATAAGAAAAGAAAGCTTCATGG + Intergenic
1200776142 Y:7171922-7171944 AACAAGCAAAGAAATCTCCAAGG + Intergenic
1201407588 Y:13664218-13664240 AGCAAGCAAAGAAATCTCCAAGG - Intergenic
1201455037 Y:14160368-14160390 AACAAGCAAATAAATCTCCAAGG + Intergenic
1201516056 Y:14819576-14819598 AACAAGCAAAGAAATATCCAAGG - Intronic
1201530477 Y:14985595-14985617 AACAAGCAAAGAAATCTCCATGG + Intergenic
1201604644 Y:15771587-15771609 AACAAGGAAATAAATCTCGAAGG + Intergenic
1201729663 Y:17190513-17190535 AATAAGCAAAGAAATCTCCAAGG - Intergenic
1201744065 Y:17351811-17351833 AATAAGCAAAGAAATCTCCAAGG - Intergenic
1201911027 Y:19133659-19133681 AACAAGCAAAGAAATCCCCAGGG + Intergenic
1201989595 Y:20009354-20009376 AACAAGGAAATAAATCTCCAAGG - Intergenic