ID: 1201530479

View in Genome Browser
Species Human (GRCh38)
Location Y:14985613-14985635
Sequence CATGGTACCACAAAACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201530476_1201530479 8 Left 1201530476 Y:14985582-14985604 CCACACAGAAGGAAACAAGCAAA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530470_1201530479 24 Left 1201530470 Y:14985566-14985588 CCTCCTCTAATCTCCCCCACACA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530473_1201530479 11 Left 1201530473 Y:14985579-14985601 CCCCCACACAGAAGGAAACAAGC No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530474_1201530479 10 Left 1201530474 Y:14985580-14985602 CCCCACACAGAAGGAAACAAGCA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530471_1201530479 21 Left 1201530471 Y:14985569-14985591 CCTCTAATCTCCCCCACACAGAA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data
1201530475_1201530479 9 Left 1201530475 Y:14985581-14985603 CCCACACAGAAGGAAACAAGCAA No data
Right 1201530479 Y:14985613-14985635 CATGGTACCACAAAACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201530479 Original CRISPR CATGGTACCACAAAACCTCC TGG Intergenic
No off target data available for this crispr