ID: 1201536486

View in Genome Browser
Species Human (GRCh38)
Location Y:15053775-15053797
Sequence TTGTTTTAACCTAAGCCATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201536483_1201536486 27 Left 1201536483 Y:15053725-15053747 CCTATTCGGCCATCTTGGCTGCC 0: 95
1: 205
2: 2231
3: 1760
4: 1514
Right 1201536486 Y:15053775-15053797 TTGTTTTAACCTAAGCCATGCGG No data
1201536484_1201536486 18 Left 1201536484 Y:15053734-15053756 CCATCTTGGCTGCCAGTAGCAAA No data
Right 1201536486 Y:15053775-15053797 TTGTTTTAACCTAAGCCATGCGG No data
1201536485_1201536486 6 Left 1201536485 Y:15053746-15053768 CCAGTAGCAAAATATATTTATTT No data
Right 1201536486 Y:15053775-15053797 TTGTTTTAACCTAAGCCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201536486 Original CRISPR TTGTTTTAACCTAAGCCATG CGG Intergenic
No off target data available for this crispr