ID: 1201536905

View in Genome Browser
Species Human (GRCh38)
Location Y:15059250-15059272
Sequence GTCATTGTGACACGTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201536901_1201536905 12 Left 1201536901 Y:15059215-15059237 CCTTATCTCTACCAAAAAAGAAA 0: 5
1: 159
2: 2202
3: 14005
4: 70496
Right 1201536905 Y:15059250-15059272 GTCATTGTGACACGTGTCTTTGG No data
1201536902_1201536905 1 Left 1201536902 Y:15059226-15059248 CCAAAAAAGAAAAAAAAAAAGCC No data
Right 1201536905 Y:15059250-15059272 GTCATTGTGACACGTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201536905 Original CRISPR GTCATTGTGACACGTGTCTT TGG Intergenic
No off target data available for this crispr