ID: 1201537246

View in Genome Browser
Species Human (GRCh38)
Location Y:15064184-15064206
Sequence GAAAACCTAGGCAATACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201537246_1201537251 1 Left 1201537246 Y:15064184-15064206 CCAGTGGTATTGCCTAGGTTTTC No data
Right 1201537251 Y:15064208-15064230 TCTGGGGTTTTTACCGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201537246 Original CRISPR GAAAACCTAGGCAATACCAC TGG (reversed) Intergenic
No off target data available for this crispr