ID: 1201538784

View in Genome Browser
Species Human (GRCh38)
Location Y:15083707-15083729
Sequence CTGTCAACAGAGAACGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201538784_1201538788 7 Left 1201538784 Y:15083707-15083729 CCTTGTTCGTTCTCTGTTGACAG No data
Right 1201538788 Y:15083737-15083759 TGGATGAATTAAATAAGTTAAGG No data
1201538784_1201538789 8 Left 1201538784 Y:15083707-15083729 CCTTGTTCGTTCTCTGTTGACAG No data
Right 1201538789 Y:15083738-15083760 GGATGAATTAAATAAGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201538784 Original CRISPR CTGTCAACAGAGAACGAACA AGG (reversed) Intergenic
No off target data available for this crispr