ID: 1201539149

View in Genome Browser
Species Human (GRCh38)
Location Y:15087362-15087384
Sequence CCTTTTAAGCAGTTAATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201539144_1201539149 -2 Left 1201539144 Y:15087341-15087363 CCCGAACAAAGGAAACAGCAACC No data
Right 1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG No data
1201539141_1201539149 13 Left 1201539141 Y:15087326-15087348 CCGGAAAGTCTGAGCCCCGAACA 0: 9
1: 14
2: 16
3: 25
4: 98
Right 1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG No data
1201539143_1201539149 -1 Left 1201539143 Y:15087340-15087362 CCCCGAACAAAGGAAACAGCAAC No data
Right 1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG No data
1201539145_1201539149 -3 Left 1201539145 Y:15087342-15087364 CCGAACAAAGGAAACAGCAACCT No data
Right 1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201539149 Original CRISPR CCTTTTAAGCAGTTAATGGT GGG Intergenic
No off target data available for this crispr