ID: 1201543512

View in Genome Browser
Species Human (GRCh38)
Location Y:15134787-15134809
Sequence CGGGTTGTTAAAGTCTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201543512_1201543515 20 Left 1201543512 Y:15134787-15134809 CCATAAAAGACTTTAACAACCCG No data
Right 1201543515 Y:15134830-15134852 AACGCAAAAGAGAATTAAAAAGG No data
1201543512_1201543516 29 Left 1201543512 Y:15134787-15134809 CCATAAAAGACTTTAACAACCCG No data
Right 1201543516 Y:15134839-15134861 GAGAATTAAAAAGGATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201543512 Original CRISPR CGGGTTGTTAAAGTCTTTTA TGG (reversed) Intergenic
No off target data available for this crispr