ID: 1201543787

View in Genome Browser
Species Human (GRCh38)
Location Y:15138331-15138353
Sequence CAGGCCCACCTGCAGCTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201543783_1201543787 6 Left 1201543783 Y:15138302-15138324 CCACCTCTTGTGGAGGTCCTGAC No data
Right 1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG No data
1201543782_1201543787 9 Left 1201543782 Y:15138299-15138321 CCACCACCTCTTGTGGAGGTCCT No data
Right 1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG No data
1201543784_1201543787 3 Left 1201543784 Y:15138305-15138327 CCTCTTGTGGAGGTCCTGACATC No data
Right 1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201543787 Original CRISPR CAGGCCCACCTGCAGCTACC CGG Intergenic
No off target data available for this crispr