ID: 1201545055

View in Genome Browser
Species Human (GRCh38)
Location Y:15152805-15152827
Sequence CAGTTGCTTTTAAGGACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201545053_1201545055 -9 Left 1201545053 Y:15152791-15152813 CCTAAAAATCTCTGCAGTTGCTT No data
Right 1201545055 Y:15152805-15152827 CAGTTGCTTTTAAGGACTAAAGG No data
1201545052_1201545055 13 Left 1201545052 Y:15152769-15152791 CCTCAATTTTCATGAAATTTGAC No data
Right 1201545055 Y:15152805-15152827 CAGTTGCTTTTAAGGACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201545055 Original CRISPR CAGTTGCTTTTAAGGACTAA AGG Intergenic
No off target data available for this crispr