ID: 1201545055 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:15152805-15152827 |
Sequence | CAGTTGCTTTTAAGGACTAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201545053_1201545055 | -9 | Left | 1201545053 | Y:15152791-15152813 | CCTAAAAATCTCTGCAGTTGCTT | No data | ||
Right | 1201545055 | Y:15152805-15152827 | CAGTTGCTTTTAAGGACTAAAGG | No data | ||||
1201545052_1201545055 | 13 | Left | 1201545052 | Y:15152769-15152791 | CCTCAATTTTCATGAAATTTGAC | No data | ||
Right | 1201545055 | Y:15152805-15152827 | CAGTTGCTTTTAAGGACTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201545055 | Original CRISPR | CAGTTGCTTTTAAGGACTAA AGG | Intergenic | ||
No off target data available for this crispr |