ID: 1201550902

View in Genome Browser
Species Human (GRCh38)
Location Y:15215423-15215445
Sequence ACCCAAAATGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201550902_1201550903 4 Left 1201550902 Y:15215423-15215445 CCATGTCTGGAGACATTTTGGGT No data
Right 1201550903 Y:15215450-15215472 ATAACCCAGTTAGCATCTGTTGG No data
1201550902_1201550908 17 Left 1201550902 Y:15215423-15215445 CCATGTCTGGAGACATTTTGGGT No data
Right 1201550908 Y:15215463-15215485 CATCTGTTGGGTAGAGACCAGGG No data
1201550902_1201550907 16 Left 1201550902 Y:15215423-15215445 CCATGTCTGGAGACATTTTGGGT No data
Right 1201550907 Y:15215462-15215484 GCATCTGTTGGGTAGAGACCAGG No data
1201550902_1201550904 5 Left 1201550902 Y:15215423-15215445 CCATGTCTGGAGACATTTTGGGT No data
Right 1201550904 Y:15215451-15215473 TAACCCAGTTAGCATCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201550902 Original CRISPR ACCCAAAATGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr