ID: 1201555099

View in Genome Browser
Species Human (GRCh38)
Location Y:15259002-15259024
Sequence ATGCACTTGAAGGATTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201555099_1201555105 16 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555105 Y:15259041-15259063 AAAAGGGTCTGTTAAACTCTGGG No data
1201555099_1201555101 -7 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555101 Y:15259018-15259040 AGTGCATGAAGCATTATATAAGG No data
1201555099_1201555107 18 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG No data
1201555099_1201555102 -1 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555102 Y:15259024-15259046 TGAAGCATTATATAAGGAAAAGG No data
1201555099_1201555106 17 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555106 Y:15259042-15259064 AAAGGGTCTGTTAAACTCTGGGG No data
1201555099_1201555104 15 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555104 Y:15259040-15259062 GAAAAGGGTCTGTTAAACTCTGG No data
1201555099_1201555108 23 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555108 Y:15259048-15259070 TCTGTTAAACTCTGGGGGAAAGG No data
1201555099_1201555103 0 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555103 Y:15259025-15259047 GAAGCATTATATAAGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201555099 Original CRISPR ATGCACTTGAAGGATTAGAA AGG (reversed) Intergenic
No off target data available for this crispr